| Allele Name | tm1739 |
| Balance | Completed |
| OutCross | Not Accepted |
| Sequence Name | T06A10.1 |
| Gene Name | mel-46 |
| Worm Base | Allele Name |
tm1739
(x1) |
| Gene Name |
mel-46
|
| Sequence |
T06A10.1
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| lethal or sterile. Dr. A. Streit: late larval lethal, fails to complement the mel-46(yt5ts) and affects ceh-13::gfp expression. BMC Dev Biol. 9, 35 (2009). |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 7239/7240-7664/7665 (425 bp deletion) |
| Chromosome | IV |
| Putative gene structure | complement(join(163..342, 1092..1397, 3370..4569, 5701..6124, 6636..6765, 7432..7556, 7622..7760, 7816..7871, 8068..8331, 8411..8478)) |
| Map position | 15.38 |
| Balancer | nT1 [qIs51] |
| Map position of balancer | |
| Sequence of primers | IntRev:CGTTCGCTAAACTCCGCCCA,ExtRev:GTGTGCGGCGCTATTGCGTT,ExtFwd:CACCAGTGCCTGCACGTATC,IntFwd:AGAGCACTTTGCGACTACGT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
O'Hern PJ, do Carmo G Gonçalves I, Brecht J, López Soto EJ, Simon J, Chapkis N, Lipscombe D, Kye MJ, Hart AC. Decreased microRNA levels lead to deleterious increases in neuronal M2 muscarinic receptors in Spinal Muscular Atrophy models. Elife 2017 6
[ PubMed ID = 28463115 ]
[ RRC reference ]
|
Minasaki R, Puoti A, Streit A. The DEAD-box protein MEL-46 is required in the germ line of the nematode Caenorhabditis elegans. BMC Dev Biol 2009 9 35
[ PubMed ID = 19534797 ]
[ RRC reference ]
|
|