Home > Mutants (Isolated) > tm1739

Mutants (Isolated)

Allele Name		tm1739
Allele Type		Balanced
Sequence Name		T06A10.1
Gene Name		mel-46
Worm Base	Allele Name	tm1739
	Gene Name	mel-46
	Sequence	T06A10.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile. Dr. A. Streit: late larval lethal, fails to complement the mel-46(yt5ts) and affects ceh-13::gfp expression. BMC Dev Biol. 9, 35 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		7239/7240-7664/7665 (425 bp deletion)
Chromosome		IV
Putative gene structure		complement(join(163..342, 1092..1397, 3370..4569, 5701..6124, 6636..6765, 7432..7556, 7622..7760, 7816..7871, 8068..8331, 8411..8478))
Map position		15.38
Balancer		nT1 [qIs51]
Map position of balancer
Sequence of primers		IntRev:CGTTCGCTAAACTCCGCCCA,ExtRev:GTGTGCGGCGCTATTGCGTT,ExtFwd:CACCAGTGCCTGCACGTATC,IntFwd:AGAGCACTTTGCGACTACGT
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication O'Hern PJ, do Carmo G Gonçalves I, Brecht J, López Soto EJ, Simon J, Chapkis N, Lipscombe D, Kye MJ, Hart AC. Decreased microRNA levels lead to deleterious increases in neuronal M2 muscarinic receptors in Spinal Muscular Atrophy models. Elife 2017 6   [ PubMed ID = 28463115 ] [ RRC reference ] Minasaki R, Puoti A, Streit A. The DEAD-box protein MEL-46 is required in the germ line of the nematode Caenorhabditis elegans. BMC Dev Biol 2009 9 35  [ PubMed ID = 19534797 ] [ RRC reference ]