Mutants (Isolated)

tm1736

Allele Nametm1736
Allele TypeNormal
Sequence NameC27C12.2
Gene Nameegrh-1
Worm BaseAllele Name tm1736
Gene Name egrh-1
Sequence C27C12.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. A. Streit: no effect on ceh-13::gfp expression. Dr. R. Waterston: Dead eggs= 27/227.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16643/16644-17313/17314 (670 bp deletion)
ChromosomeX
Putative gene structurejoin(16191..16331,16381..16744,16795..16937,17100..17394, 17447..17515, 17562..17635, 17695..17820, 18522..18677, 18726..18740)
Map position21.44
Balancer
Map position of balancer
Sequence of primersExtRev:TACTAGTTGCTCAGTACCTG,IntFwd:GGGGAAGCAACGATCTCCTT,IntRev:ATGTCTCGTCAGCTCGTCAC,ExtFwd:CATGTGCCACTTGGGGGAAG
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Chen D, Xu W, Wang Y, Ye Y, Wang Y, Yu M, Gao J, Wei J, Dong Y, Zhang H, Fu X, Ma K, Wang H, Yang Z, Zhou J, Cheng W, Wang S, Chen J, Grant BD, Myers CL, Shi A, Xia T.
Revealing Functional Crosstalk between Distinct Bioprocesses through Reciprocal Functional Tests of Genetically Interacting Genes.
Cell Rep 2019 29(9) 2646-2658.e5 
[ PubMed ID = 31775035 ] [ RRC reference ]

Clary LM, Okkema PG.
The EGR family gene egrh-1 functions non-autonomously in the control of oocyte meiotic maturation and ovulation in C. elegans.
Development 2010 137(18) 3129-37 
[ PubMed ID = 20736289 ] [ RRC reference ]