Mutants (Isolated)

tm1703

Allele Nametm1703
BalanceNot Required
OutCrossNot Accepted
Sequence NameF19H8.3
Gene Namearl-3
Worm BaseAllele Name tm1703
Gene Name arl-3
Sequence F19H8.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. P. Sengupta: dyf+ in all sensory neurons. Dr. M. Leroux: Dyf normal. Dr. M. Barr: male mating behavior: slightly Lov defective. Dr. M. Han: wild-type (growth rate, brood size, vulva). Dr. K. Shen: Post- and pre-synaptic sites develp normal in AVE as determined by GLR-1::YFP and CFP::RAB-3 localization. Dr. O. Blacque: normal dye filling and normal osmolarity sensing. Dr. S. Eimer: normal levamisole receptor trafficking.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10372/10373-GTCTCGACAACGCTTCTCTCGACAACGCCG-11267/11268 (895 bp deletion + 30 bp insertion)
ChromosomeII
Putative gene structurejoin(10283..10710, 10996..11122)
Map position23.17
Balancer
Map position of balancer
Sequence of primersExtFwd:TAACGCAAGGCTTACACTTG,IntFwd:GGCAGGCACCAAGTTTTACT,ExtRev:AGAGCAGCTCAACGGCCTAA,IntRev:GTGAGCTGATGAGTGTCTGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Akella JS, Carter SP, Nguyen K, Tsiropoulou S, Moran AL, Silva M, Rizvi F, Kennedy BN, Hall DH, Barr MM, Blacque OE.
Ciliary Rab28 and the BBSome negatively regulate extracellular vesicle shedding.
Elife 2020 9  
[ PubMed ID = 32101165 ] [ RRC reference ]

Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198 
[ PubMed ID = 27306325 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84 
[ PubMed ID = 24646679 ] [ RRC reference ]

Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P.
Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.
J Cell Sci 2013 126(Pt 19) 4381-95 
[ PubMed ID = 23886944 ] [ RRC reference ]

Li Y, Wei Q, Zhang Y, Ling K, Hu J.
The small GTPases ARL-13 and ARL-3 coordinate intraflagellar transport and ciliogenesis.
J Cell Biol 2010 189(6) 1039-51 
[ PubMed ID = 20530210 ] [ RRC reference ]