Mutants (Isolated)

tm1703

Allele Name

tm1703

Sequence Name

F19H8.3

CGC Name

arl-3

Worm Base

Allele Name

tm1703

CGC Name

arl-3

Sequence

F19H8.3

Phenotype

homozygous viable. Dr. P. Sengupta: dyf+ in all sensory neurons. Dr. M. Leroux: Dyf normal. Dr. M. Barr: male mating behavior: slightly Lov defective. Dr. M. Han: wild-type (growth rate, brood size, vulva). Dr. K. Shen: Post- and pre-synaptic sites develp normal in AVE as determined by GLR-1::YFP and CFP::RAB-3 localization. Dr. O. Blacque: normal dye filling and normal osmolarity sensing. Dr. S. Eimer: normal levamisole receptor trafficking.

Mutation site

10372/10373-GTCTCGACAACGCTTCTCTCGACAACGCCG-11267/11268 (895 bp deletion + 30 bp insertion)

Chromosome

Putative gene structure

join(10283..10710, 10996..11122)

Map position

23.17

Balancer

Map position of balancer

Sequence of primers

ExtFwd:TAACGCAAGGCTTACACTTG,IntFwd:GGCAGGCACCAAGTTTTACT,ExtRev:AGAGCAGCTCAACGGCCTAA,IntRev:GTGAGCTGATGAGTGTCTGA

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Akella JS, Carter SP, Nguyen K, Tsiropoulou S, Moran AL, Silva M, Rizvi F, Kennedy BN, Hall DH, Barr MM, Blacque OE.
Ciliary Rab28 and the BBSome negatively regulate extracellular vesicle shedding.
Elife 2020 9
[ PubMed ID = 32101165 ] [ RRC reference ]

Li Y, Wei Q, Zhang Y, Ling K, Hu J.
The small GTPases ARL-13 and ARL-3 coordinate intraflagellar transport and ciliogenesis.
J Cell Biol 2010 189(6) 1039-51
[ PubMed ID = 20530210 ] [ RRC reference ]

Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198
[ PubMed ID = 27306325 ] [ RRC reference ]

Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P.
Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans.
J Cell Sci 2013 126(Pt 19) 4381-95
[ PubMed ID = 23886944 ] [ RRC reference ]

Brear AG, Yoon J, Wojtyniak M, Sengupta P.
Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia.
Genetics 2014 197(2) 667-84
[ PubMed ID = 24646679 ] [ RRC reference ]