Home > Mutants (Isolated) > tm1703

Mutants (Isolated)

Allele Name		tm1703
Allele Type		Normal
Sequence Name		F19H8.3
Gene Name		arl-3
Worm Base	Allele Name	tm1703
	Gene Name	arl-3
	Sequence	F19H8.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. P. Sengupta: dyf+ in all sensory neurons. Dr. M. Leroux: Dyf normal. Dr. M. Barr: male mating behavior: slightly Lov defective. Dr. M. Han: wild-type (growth rate, brood size, vulva). Dr. K. Shen: Post- and pre-synaptic sites develp normal in AVE as determined by GLR-1::YFP and CFP::RAB-3 localization. Dr. O. Blacque: normal dye filling and normal osmolarity sensing. Dr. S. Eimer: normal levamisole receptor trafficking.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		10372/10373-GTCTCGACAACGCTTCTCTCGACAACGCCG-11267/11268 (895 bp deletion + 30 bp insertion)
Chromosome		II
Putative gene structure		join(10283..10710, 10996..11122)
Map position		23.17
Balancer
Map position of balancer
Sequence of primers		ExtFwd:TAACGCAAGGCTTACACTTG,IntFwd:GGCAGGCACCAAGTTTTACT,ExtRev:AGAGCAGCTCAACGGCCTAA,IntRev:GTGAGCTGATGAGTGTCTGA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Murari E, Meadows D, Cuda N, Mangone M. A comprehensive analysis of 3'UTRs in Caenorhabditis elegans. Nucleic Acids Res 2024 52(13) 7523-7538  [ PubMed ID = 38917330 ] [ RRC reference ] Weng Y, Murphy CT. Male-specific behavioral and transcriptomic changes in aging C. elegans neurons. iScience 2024 27(6) 109910  [ PubMed ID = 38783998 ] [ RRC reference ] Akella JS, Carter SP, Nguyen K, Tsiropoulou S, Moran AL, Silva M, Rizvi F, Kennedy BN, Hall DH, Barr MM, Blacque OE. Ciliary Rab28 and the BBSome negatively regulate extracellular vesicle shedding. Elife 2020 9   [ PubMed ID = 32101165 ] [ RRC reference ] Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S. Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans. Sci Rep 2016 6 28198  [ PubMed ID = 27306325 ] [ RRC reference ] Li Y, Wei Q, Zhang Y, Ling K, Hu J. The small GTPases ARL-13 and ARL-3 coordinate intraflagellar transport and ciliogenesis. J Cell Biol 2010 189(6) 1039-51  [ PubMed ID = 20530210 ] [ RRC reference ] Wojtyniak M, Brear AG, O'Halloran DM, Sengupta P. Cell- and subunit-specific mechanisms of CNG channel ciliary trafficking and localization in C. elegans. J Cell Sci 2013 126(Pt 19) 4381-95  [ PubMed ID = 23886944 ] [ RRC reference ] Brear AG, Yoon J, Wojtyniak M, Sengupta P. Diverse cell type-specific mechanisms localize G protein-coupled receptors to Caenorhabditis elegans sensory cilia. Genetics 2014 197(2) 667-84  [ PubMed ID = 24646679 ] [ RRC reference ]