| Allele Name | tm1682 |
| Allele Type | 通常株 |
| Sequence Name | F57B10.6 |
| Gene Name | xpg-1 |
| Worm Base | Allele Name |
tm1682
|
| Gene Name |
xpg-1
|
| Sequence |
F57B10.6
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. M. Driscoll: no effect on necrotic cell death. Dr. W. Vermeulen: normal locomotion but UV sensitive. Dr. S. Boulton: not Him, does not genetically interact with him-9 or him-6. |
|
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 9992/9993-10871/10872 (879 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(10316..10403, 10538..10803, 11239..11565, 11621..11704, 11962..12397, 12445..12918, 12969..13129, 13176..13307, 13394..13915) |
| Map position | 1.21 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:TCTGGTCCAGTTACGTTGAT,IntFwd:ACGGAGATCAATTTGCATCC,IntRev:GAGTATCCACCTGTGGAGGT,ExtFwd:GGTTGGACAAATGGCGTTAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Stergiou L, Eberhard R, Doukoumetzidis K, Hengartner MO.
NER and HR pathways act sequentially to promote UV-C-induced germ cell apoptosis in Caenorhabditis elegans.
Cell Death Differ 2011 18(5) 897-906
[ PubMed ID = 21151025 ]
[ RRC reference ]
|
Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795
[ PubMed ID = 22091407 ]
[ RRC reference ]
|
Lans H, Lindvall JM, Thijssen K, Karambelas AE, Cupac D, Fensgård O, Jansen G, Hoeijmakers JH, Nilsen H, Vermeulen W.
DNA damage leads to progressive replicative decline but extends the life span of long-lived mutant animals.
Cell Death Differ 2013 20(12) 1709-18
[ PubMed ID = 24013725 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.