Mutants (Isolated)

tm1682

Allele Nametm1682
Sequence NameF57B10.6
CGC Namexpg-1
Worm BaseAllele Name tm1682
CGC Name xpg-1
Sequence F57B10.6
Phenotypehomozygous viable. Dr. M. Driscoll: no effect on necrotic cell death. Dr. W. Vermeulen: normal locomotion but UV sensitive. Dr. S. Boulton: not Him, does not genetically interact with him-9 or him-6.
Mutation site9992/9993-10871/10872 (879 bp deletion)
ChromosomeI
Putative gene structurejoin(10316..10403, 10538..10803, 11239..11565, 11621..11704, 11962..12397, 12445..12918, 12969..13129, 13176..13307, 13394..13915)
Map position1.21
Balancer
Map position of balancer
Sequence of primersExtRev:TCTGGTCCAGTTACGTTGAT,IntFwd:ACGGAGATCAATTTGCATCC,IntRev:GAGTATCCACCTGTGGAGGT,ExtFwd:GGTTGGACAAATGGCGTTAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Stergiou L, Eberhard R, Doukoumetzidis K, Hengartner MO.
NER and HR pathways act sequentially to promote UV-C-induced germ cell apoptosis in Caenorhabditis elegans.
Cell Death Differ. 2011 18(5) 897-906 
[ PubMed ID = 21151025 ] [ RRC reference ]

Lans H, Lindvall JM, Thijssen K, Karambelas AE, Cupac D, Fensgård O, Jansen G, Hoeijmakers JH, Nilsen H, Vermeulen W.
DNA damage leads to progressive replicative decline but extends the life span of long-lived mutant animals.
Cell Death Differ. 2013 20(12) 1709-18 
[ PubMed ID = 24013725 ] [ RRC reference ]

Lans H, Vermeulen W.
Nucleotide Excision Repair in Caenorhabditis elegans.
Mol Biol Int 2011 2011 542795 
[ PubMed ID = 22091407 ] [ RRC reference ]