Mutants (Isolated)

tm1655

Allele Nametm1655
BalanceNot Required
OutCrossNot Accepted
Sequence NameC54G7.2
Gene Namemboa-3
Worm BaseAllele Name tm1655
Gene Name mboa-3
Sequence C54G7.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H.C. Korswagen: no defects in Wnt signaling as judged by Q neuroblast migration.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3495/3496-4522/4523 (1027 bp deletion)
ChromosomeX
Putative gene structurecomplement(join(1586..1876, 2144..2448, 2499..2790, 2838..3087, 3787..3864, 3934..4079, 4133..4213))
Map position-4.99
Balancer
Map position of balancer
Sequence of primersExtFwd:CACTGAATCCAAAACCGGAC,IntFwd:CTTATACTTGCCACCAAGAG,ExtRev:ATGTGCGTCGTCCGGGATGA,IntRev:ATTAGACCTTGACCGGCACT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li Q, Zhou X, Zhang X, Zhang C, Zhang SO.
Nuclear receptor signaling regulates compartmentalized phosphatidylcholine remodeling to facilitate thermosensitive lipid droplet fusion.
Nat Commun 2025 16(1) 3955 
[ PubMed ID = 40289189 ] [ RRC reference ]