分離済み変異体

tm1637

Allele Nametm1637
BalanceNot Required
OutCrossNot Accepted
Sequence NameC04F12.1
Gene NameC04F12.1
Worm BaseAllele Name tm1637
Gene Name C04F12.1
Sequence C04F12.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006). Dr. R. Lu: PLoS Pathogens 5, e1000286 (2009).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3597/3598-4395/4396 (798 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(1623..1740, 1791..2082, 2431..2770, 3173..3287, 3488..3574, 3626..3780, 3827..4069, 4115..4683, 4821..5651, 6179..6263))
Map position3.85
Balancer
Map position of balancer
Sequence of primersIntFwd:AACGCAGCTTGGCTCGTCAC,ExtFwd:CGCGCCTAATCCATGCTATC,IntRev:TCGTTACGACGTCAGTGTTC,ExtRev:CGAGTACGAACCTCCAGCAC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Castiglioni VG, Olmo-Uceda MJ, Villena-Giménez A, Muñoz-Sánchez JC, Legarda EG, Elena SF.
Story of an infection: Viral dynamics and host responses in the Caenorhabditis elegans-Orsay virus pathosystem.
Sci Adv 2024 10(39) eadn5945 
[ PubMed ID = 39331715 ] [ RRC reference ]

Tabara H, Mitani S, Mochizuki M, Kohara Y, Nagata K.
A small RNA system ensures accurate homologous pairing and unpaired silencing of meiotic chromosomes.
EMBO J 2023 42(11) e105002 
[ PubMed ID = 37078421 ] [ RRC reference ]

Kennedy LM, Grishok A.
Neuronal migration is regulated by endogenous RNAi and chromatin-binding factor ZFP-1/AF10 in Caenorhabditis elegans.
Genetics 2014 197(1) 207-20 
[ PubMed ID = 24558261 ] [ RRC reference ]

Luteijn MJ, van Bergeijk P, Kaaij LJ, Almeida MV, Roovers EF, Berezikov E, Ketting RF.
Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans.
EMBO J 2012 31(16) 3422-30 
[ PubMed ID = 22850670 ] [ RRC reference ]

Wu X, Shi Z, Cui M, Han M, Ruvkun G.
Repression of germline RNAi pathways in somatic cells by retinoblastoma pathway chromatin complexes.
PLoS Genet 2012 8(3) e1002542 
[ PubMed ID = 22412383 ] [ RRC reference ]

Corrêa RL, Steiner FA, Berezikov E, Ketting RF.
MicroRNA-directed siRNA biogenesis in Caenorhabditis elegans.
PLoS Genet 2010 6(4) e1000903 
[ PubMed ID = 20386745 ] [ RRC reference ]

Vasale JJ, Gu W, Thivierge C, Batista PJ, Claycomb JM, Youngman EM, Duchaine TF, Mello CC, Conte D Jr.
Sequential rounds of RNA-dependent RNA transcription drive endogenous small-RNA biogenesis in the ERGO-1/Argonaute pathway.
Proc Natl Acad Sci U S A 2010 107(8) 3582-7 
[ PubMed ID = 20133583 ] [ RRC reference ]

Gu W, Shirayama M, Conte D Jr, Vasale J, Batista PJ, Claycomb JM, Moresco JJ, Youngman EM, Keys J, Stoltz MJ, Chen CC, Chaves DA, Duan S, Kasschau KD, Fahlgren N, Yates JR 3rd, Mitani S, Carrington JC, Mello CC.
Distinct argonaute-mediated 22G-RNA pathways direct genome surveillance in the C. elegans germline.
Mol Cell 2009 36(2) 231-44 
[ PubMed ID = 19800275 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]

Lu R, Yigit E, Li WX, Ding SW.
An RIG-I-Like RNA helicase mediates antiviral RNAi downstream of viral siRNA biogenesis in Caenorhabditis elegans.
PLoS Pathog 2009 5(2) e1000286 
[ PubMed ID = 19197349 ] [ RRC reference ]