分離済み変異体

tm1630

Allele Nametm1630
BalanceNot Required
OutCrossNot Accepted
Sequence NameC26E6.9
Gene Nameset-2
Worm BaseAllele Name tm1630
Gene Name set-2
Sequence C26E6.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr.W.G. Kelly: WT and fertile.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12135/12136-12564/12565 (429 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(5391..5546, 5600..5764, 5814..5924, 5972..6283, 6331..6558, 6622..7629, 8076..8126, 8886..9134, 9189..9992, 10078..10466, 11062..11250, 11322..11570, 11748..11920, 11971..12212, 12264..12401, 12461..12520))
Map position-2.35
Balancer
Map position of balancer
Sequence of primersExtFwd:CTGCTTCGTCCAACCGCCAA,ExtRev:GGCCGCGGCTATTTGACCTA,IntFwd:GATCGTCAATGTTCGGTTCA,IntRev:CCTAGAAACGTCACCACGCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Abay-Nørgaard S, Attianese B, Boreggio L, Salcini AE.
Regulators of H3K4 methylation mutated in neurodevelopmental disorders control axon guidance in Caenorhabditis elegans.
Development 2020 147(15)  
[ PubMed ID = 32675280 ] [ RRC reference ]

Li T, Kelly WG.
A role for WDR5 in TRA-1/Gli mediated transcriptional control of the sperm/oocyte switch in C. elegans.
Nucleic Acids Res 2014 42(9) 5567-81 
[ PubMed ID = 24682813 ] [ RRC reference ]

Li T, Kelly WG.
A role for Set1/MLL-related components in epigenetic regulation of the Caenorhabditis elegans germ line.
PLoS Genet 2011 7(3) e1001349 
[ PubMed ID = 21455483 ] [ RRC reference ]

Wagner CR, Kuervers L, Baillie DL, Yanowitz JL.
xnd-1 regulates the global recombination landscape in Caenorhabditis elegans.
Nature 2010 467(7317) 839-43 
[ PubMed ID = 20944745 ] [ RRC reference ]