| Allele Name | tm1630 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | C26E6.9 |
| Gene Name | set-2 |
| Worm Base | Allele Name |
tm1630
|
| Gene Name |
set-2
|
| Sequence |
C26E6.9
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr.W.G. Kelly: WT and fertile. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 12135/12136-12564/12565 (429 bp deletion) |
| Chromosome | III |
| Putative gene structure | complement(join(5391..5546, 5600..5764, 5814..5924, 5972..6283, 6331..6558, 6622..7629, 8076..8126, 8886..9134, 9189..9992, 10078..10466, 11062..11250, 11322..11570, 11748..11920, 11971..12212, 12264..12401, 12461..12520)) |
| Map position | -2.35 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CTGCTTCGTCCAACCGCCAA,ExtRev:GGCCGCGGCTATTTGACCTA,IntFwd:GATCGTCAATGTTCGGTTCA,IntRev:CCTAGAAACGTCACCACGCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Abay-Nørgaard S, Attianese B, Boreggio L, Salcini AE. Regulators of H3K4 methylation mutated in neurodevelopmental disorders control axon guidance in Caenorhabditis elegans. Development 2020 147(15)
[ PubMed ID = 32675280 ]
[ RRC reference ]
|
Li T, Kelly WG. A role for WDR5 in TRA-1/Gli mediated transcriptional control of the sperm/oocyte switch in C. elegans. Nucleic Acids Res 2014 42(9) 5567-81
[ PubMed ID = 24682813 ]
[ RRC reference ]
|
Li T, Kelly WG. A role for Set1/MLL-related components in epigenetic regulation of the Caenorhabditis elegans germ line. PLoS Genet 2011 7(3) e1001349
[ PubMed ID = 21455483 ]
[ RRC reference ]
|
Wagner CR, Kuervers L, Baillie DL, Yanowitz JL. xnd-1 regulates the global recombination landscape in Caenorhabditis elegans. Nature 2010 467(7317) 839-43
[ PubMed ID = 20944745 ]
[ RRC reference ]
|
|