Mutants (Isolated)

tm1621

Allele Nametm1621
Allele TypeNormal
Sequence NameF11E6.6
Gene NameF11E6.6
Worm BaseAllele Name tm1621
Gene Name F11E6.6
Sequence F11E6.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 22850/22851-23144/23145 (294 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(22571..22731, 22801..22872, 23274..23451, 23496..23820, 23873..23943))
Map position17.1
Balancer
Map position of balancer
Sequence of primersIntRev:CGGAGGACTCATGTACATCA,IntFwd:GTCCGAGTCCGCCATTCGTT,ExtRev:GCTATCGATCGGAGGACTCA,ExtFwd:TACAACACAGGAGTGAGGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wagner CR, Kuervers L, Baillie DL, Yanowitz JL.
xnd-1 regulates the global recombination landscape in Caenorhabditis elegans.
Nature 2010 467(7317) 839-43 
[ PubMed ID = 20944745 ] [ RRC reference ]