Mutants (Isolated)

tm1621

Allele Nametm1621
Sequence NameF11E6.6
CGC NameF11E6.6
Worm BaseAllele Name tm1621
CGC Name F11E6.6
Sequence F11E6.6
Phenotypehomozygous viable
Mutation site22850/22851-23144/23145 (294 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(22571..22731, 22801..22872, 23274..23451, 23496..23820, 23873..23943))
Map position17.1
Balancer
Map position of balancer
Sequence of primersIntRev:CGGAGGACTCATGTACATCA,IntFwd:GTCCGAGTCCGCCATTCGTT,ExtRev:GCTATCGATCGGAGGACTCA,ExtFwd:TACAACACAGGAGTGAGGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wagner CR, Kuervers L, Baillie DL, Yanowitz JL.
xnd-1 regulates the global recombination landscape in Caenorhabditis elegans.
Nature 2010 467(7317) 839-43 
[ PubMed ID = 20944745 ] [ RRC reference ]