Home > Mutants (Isolated) > tm1621

Mutants (Isolated)

Allele Name		tm1621
Balance		Not Required
OutCross		Not Accepted
Sequence Name		F11E6.6
Gene Name		F11E6.6
Worm Base	Allele Name	tm1621
	Gene Name	F11E6.6
	Sequence	F11E6.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		22850/22851-23144/23145 (294 bp deletion)
Chromosome		IV
Putative gene structure		complement(join(22571..22731, 22801..22872, 23274..23451, 23496..23820, 23873..23943))
Map position		17.1
Balancer
Map position of balancer
Sequence of primers		IntRev:CGGAGGACTCATGTACATCA,IntFwd:GTCCGAGTCCGCCATTCGTT,ExtRev:GCTATCGATCGGAGGACTCA,ExtFwd:TACAACACAGGAGTGAGGCA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Wagner CR, Kuervers L, Baillie DL, Yanowitz JL. xnd-1 regulates the global recombination landscape in Caenorhabditis elegans. Nature 2010 467(7317) 839-43  [ PubMed ID = 20944745 ] [ RRC reference ]