Mutants (Isolated)

tm1591

Allele Nametm1591
Sequence NameF22F1.1
CGC Namehil-3
Worm BaseAllele Name tm1591
CGC Name hil-3
Sequence F22F1.1
Phenotypehomozygous viable
Mutation site10582/10583-11169/11170 (587 bp deletion)
ChromosomeX
Putative gene structurejoin(10648..10884, 10940..11329)
Map position-0.43
Balancer
Map position of balancer
Sequence of primersIntRev:CGATATTGTGCAATCCAGCA,ExtRev:ACCGTGCCAGAACAGACGAT,IntFwd:AGCGCTTTGTGTGCTATATG,ExtFwd:CTAAAGCCTCTAGCCACGTT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yeh E, Ng S, Zhang M, Bouhours M, Wang Y, Wang M, Hung W, Aoyagi K, Melnik-Martinez K, Li M, Liu F, Schafer WR, Zhen M.
A putative cation channel, NCA-1, and a novel protein, UNC-80, transmit neuronal activity in C. elegans.
PLoS Biol. 2008 6(3) e55 
[ PubMed ID = 18336069 ] [ RRC reference ]