Home > Mutants (Isolated) > tm15374

Mutants (Isolated)

tm15374

Allele Nametm15374
BalanceNot Required
OutCrossRequest Available
Sequence NameK10G9.1 T07A5.8 T07A5.4 T07A5.3 T07A5.1 T07A5.7
Gene NameK10G9.1 T07A5.8 T07A5.4 T07A5.3 T07A5.1 T07A5.7
Worm BaseAllele Name tm15374
Gene Name K10G9.1 T07A5.8 T07A5.4 T07A5.3 T07A5.1 T07A5.7
Sequence K10G9.1 T07A5.8 T07A5.4 T07A5.3 T07A5.1 T07A5.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [K10G9]16936/16937-[T07A5]11024/11025(13354 bp deletion)
ChromosomeIII
Putative gene structureK10G9.1= join(18440..18613, 18659..18805, 18966..[T07A5]254, 368..517, 583..948, 1419..1514, 1561..1618, 1772..1835, 2213..2724); T07A5.8= complement(1245..1379); T07A5.4= complement(join(3154..3419, 3497..3882, 3947..3986)); T07A5.3= join(4330..4576, 4632..4778, 5333..5887, 5990..6139, 6323..6688, 6859..6954, 7008..7065, 7126..7189, 7243..7460); T07A5.1= complement(join(7405..7578, 7831..7940, 8106..8229, 8302..8441, 8513..8621, 8725..8851, 9377..9513, 9647..9778, 10038..10225)); T07A5.7= complement(join(10334..10960, 11208..11354, 11401..11460, 11715..12214, 13482..13529, 14130..14240, 14404..14566, 15072..15137))
Map position2.25
Balancer
Map position of balancer
Sequence of primersExtRev:CACAGCTACGAACGACAAGG,ExtFwd:AAGTTTTTTCTAGGCCACCG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication