Mutants (Isolated)

tm1531

Allele Nametm1531
Sequence NameF25H2.8
CGC Nameubc-25
Worm BaseAllele Name tm1531
CGC Name ubc-25
Sequence F25H2.8
Phenotypehomozygous viable. Dr. J. Kaplan: wt locomotion and aldicarb sensitivity.
Mutation site29494/29495-30241/30242 (747 bp deletion)
ChromosomeI
Putative gene structurejoin(29083..29160, 29204..29539, 29593..30084, 30137..30289, 30342..30446)
Map position5.05
Balancer
Map position of balancer
Sequence of primersIntFwd:ACTTCTCACTCCACCTGCGT,ExtRev:ATGGGGGGTGGTTGTAGTTG,IntRev:AGAAGAGATGTACCCGCGGA,ExtFwd:CACTGCGGTCTCTGGCATCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rocheleau CE, Cullison K, Huang K, Bernstein Y, Spilker AC, Sundaram MV.
The Caenorhabditis elegans ekl (enhancer of ksr-1 lethality) genes include putative components of a germline small RNA pathway.
Genetics 2008 178(3) 1431-43 
[ PubMed ID = 18245826 ] [ RRC reference ]