Home > Mutants (Isolated) > tm15274

Mutants (Isolated)

tm15274

Allele Nametm15274
BalanceNot Required
OutCrossRequest Available
Sequence NameF02A9.10
Gene NameF02A9.10
Worm BaseAllele Name tm15274
Gene Name F02A9.10
Sequence F02A9.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15342/15343-15513/15514(171 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(14134..14450, 14496..14733, 14779..14933, 14985..15289, 15345..15942, 15989..16280, 16416..16524, 16573..16627))
Map position0.15
Balancer
Map position of balancer
Sequence of primersExtRev:AGCTGGAGGAGAAAAAGCCG,ExtFwd:CCGGCTTCAGCATCTCTTCC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lee YU, Fox BW, Guo R, Curtis BJ, Yu J, Kim S, Nanda S, Baumann V, Yilmaz LS, Haynes CM, Schroeder FC, Walhout AJM.
Host-microbe interactions rewire metabolism in a C. elegans model of leucine breakdown deficiency.
Nat Metab 2024 6(8) 1584-1600 
[ PubMed ID = 39117959 ] [ RRC reference ]