| Allele Name | tm1521 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | R05G6.8 |
| Gene Name | plc-4 |
| Worm Base | Allele Name |
tm1521
|
| Gene Name |
plc-4
|
| Sequence |
R05G6.8
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. Dr. E. Jorgensen: defacation cycle normal. Dr. I. Mori: SBN-1::Venus in RIA neurons could not be observed. |
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 9765/9766-11003/11004 (1238 bp deletion) |
| Chromosome | IV |
| Putative gene structure | complement(join(8350..8514, 8564..9108, 9153..9516, 9848..9945, 9996..10296, 10343..10729, 10891..11170, 11218..11333)) |
| Map position | 3.34 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtRev:GATAACGGAGCATCGTACCT,IntRev:TGGCCCATGCCCGCATCTTT,IntFwd:CGAGGGTGAGGATGACAGGA,ExtFwd:CGACGTGGTTTTCGAGGGTG |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Tsai Y, Lin YC, Lee YH. Octopamine-MAPK-SKN-1 signaling suppresses mating-induced oxidative stress in Caenorhabditis elegans gonads to protect fertility. iScience 2023 26(3) 106162
[ PubMed ID = 36876134 ]
[ RRC reference ]
|
Vázquez-Manrique RP, Legg JC, Olofsson B, Ly S, Baylis HA. Improved gene targeting in C. elegans using counter-selection and Flp-mediated marker excision. Genomics 2010 95(1) 37-46
[ PubMed ID = 19747540 ]
[ RRC reference ]
|
|