Mutants (Isolated)

tm1510

Allele Nametm1510
Sequence NameW03G1.6
CGC NameW03G1.6
Worm BaseAllele Name tm1510
CGC Name W03G1.6
Sequence W03G1.6
Phenotypehomozygous viable
Mutation site14907/14908-16392/16393 (1485 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(4172..4261, 10950..11290, 11645..11827, 12264..12426, 13103..13465, 14365..14565, 14616..14783, 15751..16161, 16216..16332, 16379..16461, 16510..16570))
Map position-25.4
Balancer
Map position of balancer
Sequence of primersExtFwd:CGATAGGAATTCGGGCTCGT,IntFwd:CTCGTAGAAGCATCCGGACT,ExtRev:CTAACGTGATTGCGAGAGAC,IntRev:GAGACTGTGGCAAAACGCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wei H, Yan B, Gagneur J, Conradt B.
Caenorhabditis elegans CES-1 Snail Represses pig-1 MELK Expression To Control Asymmetric Cell Division.
Genetics 2017 206(4) 2069-2084 
[ PubMed ID = 28652378 ] [ RRC reference ]