Allele Name | tm1510 |
Allele Type | Normal |
Sequence Name | W03G1.6 |
Gene Name | W03G1.6 |
Worm Base | Allele Name |
tm1510
|
Gene Name |
W03G1.6
|
Sequence |
W03G1.6
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 14907/14908-16392/16393 (1485 bp deletion) |
Chromosome | IV |
Putative gene structure | complement(join(4172..4261, 10950..11290, 11645..11827, 12264..12426, 13103..13465, 14365..14565, 14616..14783, 15751..16161, 16216..16332, 16379..16461, 16510..16570)) |
Map position | -25.4 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtFwd:CGATAGGAATTCGGGCTCGT,IntFwd:CTCGTAGAAGCATCCGGACT,ExtRev:CTAACGTGATTGCGAGAGAC,IntRev:GAGACTGTGGCAAAACGCGA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Mullan TW, Felton T, Tam J, Kasem O, Yeung TJ, Memar N, Schnabel R, Poole RJ. Control of successive unequal cell divisions by neural cell fate regulators determines embryonic neuroblast cell size. Development 2024 151(3)
[ PubMed ID = 38205939 ]
[ RRC reference ]
|
Wei H, Yan B, Gagneur J, Conradt B. Caenorhabditis elegans CES-1 Snail Represses pig-1 MELK Expression To Control Asymmetric Cell Division. Genetics 2017 206(4) 2069-2084
[ PubMed ID = 28652378 ]
[ RRC reference ]
|
|