Home > Mutants (Isolated) > tm15085

Mutants (Isolated)

tm15085

Allele Nametm15085
BalanceCompleted
OutCrossCompleted
Sequence NameF11G11.8 F11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.15 F11G11.13 F11G11.3 F11G11.2 F11G11.1
Gene NameF11G11.8 F11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.15 F11G11.13 F11G11.3 F11G11.2 F11G11.1
Worm BaseAllele Name tm15085 (x1)
Gene Name F11G11.8 F11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.15 F11G11.13 F11G11.3 F11G11.2 F11G11.1
Sequence F11G11.8 F11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.15 F11G11.13 F11G11.3 F11G11.2 F11G11.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [F11G11]9936/9937-[R05F9]1616/1617(25826 bp deletion)
ChromosomeII
Putative gene structureF11G11.8= complement(9753..10100); F11G11.4= join(10283..10385, 10740..11022, 11164..11385); F11G11.9= complement(join(12007..12275, 12324..12665, 12715..13146)); F11G11.14= join(13370..13485, 13534..13648, 14979..15094, 15143..15489); F11G11.10= complement(join(16125..16330, 16378..17263)); F11G11.11= complement(join(19296..20268, 20397..20480)); F11G11.12= complement(join(21787..21952, 22005..22816)); F11G11.15= join(24204..24421, 24472..24791); F11G11.13= complement(join(24934..25130, 25176..25355)); F11G11.3= join(29574..29737, 30187..30796); F11G11.2= join(31751..31940, 32493..33047); F11G11.1= join(33411..33575, 33752..34291)
Map position-2.99
BalancertmC6[tmIs1189]
Map position of balancer
Sequence of primersExtRev:TGTGATATTGAGCCATTGGC,ExtFwd:TGAGGACAACGAATTTGGGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication