分離済み変異体

tm1489

Allele Name

tm1489

Allele Type

通常株

Sequence Name

K01G5.2a

Gene Name

hpl-2

Worm Base

Allele Name

tm1489

Gene Name

hpl-2

Sequence

K01G5.2a

Phenotype

homozygous viable. Dr. R.H. Horvitz: not completely penetrant multivulva and sterile at 25 degree, synthetic multivulva with mutations in class A, B and C genes. Dr. M. Han: WT at 20 degree, partial Muv at 25 degree. tm1489; lin-8 (null) is partial Muv at 20C, complete and obvious Muv at 25C. tm1489; lin-15A (RNAi) is Muv at 20C. Dr. W. Vermeulen: hpl-1 (tm1624) hpl-2 (tm1489) double mutant shows severe UV sensitivity.

Mutation site

14347/14348-15019/15020 (672 bp deletion)

Chromosome

III

Putative gene structure

complement(join(13194..13266, 13966..14204, 14472..14645, 14920..14961))

Map position

5.24

Balancer

Map position of balancer

Sequence of primers

ExtFwd:GGCACTTATGTGCAGTACAG,ExtRev:TACATGCAACAAACCGCGCT,IntFwd:GTGCAGTACAGCCGGCATAT,IntRev:TCAGAGCTCCTAACCTACCT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Deshe N, Eliezer Y, Hoch L, Itskovits E, Bokman E, Ben-Ezra S, Zaslaver A.
Inheritance of associative memories and acquired cellular changes in C. elegans.
Nat Commun 2023 14(1) 4232
[ PubMed ID = 37454110 ] [ RRC reference ]

Huang M, Hong M, Hou X, Zhu C, Chen D, Chen X, Guang S, Feng X.
H3K9me1/2 methylation limits the lifespan of daf-2 mutants in C. elegans.
Elife 2022 11
[ PubMed ID = 36125117 ] [ RRC reference ]

Bujarrabal-Dueso A, Sendtner G, Meyer DH, Chatzinikolaou G, Stratigi K, Garinis GA, Schumacher B.
The DREAM complex functions as conserved master regulator of somatic DNA-repair capacities.
Nat Struct Mol Biol 2023 30(4) 475-488
[ PubMed ID = 36959262 ] [ RRC reference ]

Rodriguez-Crespo D, Nanchen M, Rajopadhye S, Wicky C.
The zinc-finger transcription factor LSL-1 is a major regulator of the germline transcriptional program in Caenorhabditis elegans.
Genetics 2022 221(1)
[ PubMed ID = 35262739 ] [ RRC reference ]

Spichal M, Heestand B, Billmyre KK, Frenk S, Mello CC, Ahmed S.
Germ granule dysfunction is a hallmark and mirror of Piwi mutant sterility.
Nat Commun 2021 12(1) 1420
[ PubMed ID = 33658512 ] [ RRC reference ]

Hsu TY, Zhang B, L'Etoile ND, Juang BT.
C. elegans orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity.
Elife 2021 10
[ PubMed ID = 33646120 ] [ RRC reference ]

Rechtsteiner A, Costello ME, Egelhofer TA, Garrigues JM, Strome S, Petrella LN.
Repression of Germline Genes in Caenorhabditis elegans Somatic Tissues by H3K9 Dimethylation of Their Promoters.
Genetics 2019 212(1) 125-140
[ PubMed ID = 30910798 ] [ RRC reference ]

Fields BD, Kennedy S.
Chromatin Compaction by Small RNAs and the Nuclear RNAi Machinery in C. elegans.
Sci Rep 2019 9(1) 9030
[ PubMed ID = 31227740 ] [ RRC reference ]

Saldi TK, Gonzales P, Garrido-Lecca A, Dostal V, Roberts CM, Petrucelli L, Link CD.
The Caenorhabditis elegans Ortholog of TDP-43 Regulates the Chromatin Localization of the Heterochromatin Protein 1 Homolog HPL-2.
Mol Cell Biol 2018 38(15)
[ PubMed ID = 29760282 ] [ RRC reference ]

McMurchy AN, Stempor P, Gaarenstroom T, Wysolmerski B, Dong Y, Aussianikava D, Appert A, Huang N, Kolasinska-Zwierz P, Sapetschnig A, Miska EA, Ahringer J.
A team of heterochromatin factors collaborates with small RNA pathways to combat repetitive elements and germline stress.
Elife 2017 6
[ PubMed ID = 28294943 ] [ RRC reference ]

Snyder MJ, Lau AC, Brouhard EA, Davis MB, Jiang J, Sifuentes MH, Csankovszki G.
Anchoring of Heterochromatin to the Nuclear Lamina Reinforces Dosage Compensation-Mediated Gene Repression.
PLoS Genet 2016 12(9) e1006341
[ PubMed ID = 27690361 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6
[ PubMed ID = 29395906 ] [ RRC reference ]

Lee CS, Lu T, Seydoux G.
Nanos promotes epigenetic reprograming of the germline by down-regulation of the THAP transcription factor LIN-15B.
Elife 2017 6
[ PubMed ID = 29111977 ] [ RRC reference ]

Herbette M, Mercier MG, Michal F, Cluet D, Burny C, Yvert G, Robert VJ, Palladino F.
The C. elegans SET-2/SET1 histone H3 Lys4 (H3K4) methyltransferase preserves genome stability in the germline.
DNA Repair (Amst) 2017 57 139-150
[ PubMed ID = 28779964 ] [ RRC reference ]

Patel T, Hobert O.
Coordinated control of terminal differentiation and restriction of cellular plasticity.
Elife 2017 6
[ PubMed ID = 28422646 ] [ RRC reference ]

Hall SE, Beverly M, Russ C, Nusbaum C, Sengupta P.
A cellular memory of developmental history generates phenotypic diversity in C. elegans.
Curr Biol 2010 20(2) 149-55
[ PubMed ID = 20079644 ] [ RRC reference ]

Wagner CR, Kuervers L, Baillie DL, Yanowitz JL.
xnd-1 regulates the global recombination landscape in Caenorhabditis elegans.
Nature 2010 467(7317) 839-43
[ PubMed ID = 20944745 ] [ RRC reference ]

Updike DL, Hachey SJ, Kreher J, Strome S.
P granules extend the nuclear pore complex environment in the C. elegans germ line.
J Cell Biol 2011 192(6) 939-48
[ PubMed ID = 21402789 ] [ RRC reference ]

Petrella LN, Wang W, Spike CA, Rechtsteiner A, Reinke V, Strome S.
synMuv B proteins antagonize germline fate in the intestine and ensure C. elegans survival.
Development 2011 138(6) 1069-79
[ PubMed ID = 21343362 ] [ RRC reference ]

Koester-Eiserfunke N, Fischle W.
H3K9me2/3 binding of the MBT domain protein LIN-61 is essential for Caenorhabditis elegans vulva development.
PLoS Genet 2011 7(3) e1002017
[ PubMed ID = 21437264 ] [ RRC reference ]