分離済み変異体

tm1489

Allele Nametm1489
BalanceNot Required
OutCrossNot Accepted
Sequence NameK01G5.2a
Gene Namehpl-2
Worm BaseAllele Name tm1489
Gene Name hpl-2
Sequence K01G5.2a
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. R.H. Horvitz: not completely penetrant multivulva and sterile at 25 degree, synthetic multivulva with mutations in class A, B and C genes. Dr. M. Han: WT at 20 degree, partial Muv at 25 degree. tm1489; lin-8 (null) is partial Muv at 20C, complete and obvious Muv at 25C. tm1489; lin-15A (RNAi) is Muv at 20C. Dr. W. Vermeulen: hpl-1 (tm1624) hpl-2 (tm1489) double mutant shows severe UV sensitivity.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14347/14348-15019/15020 (672 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(13194..13266, 13966..14204, 14472..14645, 14920..14961))
Map position5.24
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCACTTATGTGCAGTACAG,ExtRev:TACATGCAACAAACCGCGCT,IntFwd:GTGCAGTACAGCCGGCATAT,IntRev:TCAGAGCTCCTAACCTACCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Deshe N, Eliezer Y, Hoch L, Itskovits E, Bokman E, Ben-Ezra S, Zaslaver A.
Inheritance of associative memories and acquired cellular changes in C. elegans.
Nat Commun 2023 14(1) 4232 
[ PubMed ID = 37454110 ] [ RRC reference ]

Bujarrabal-Dueso A, Sendtner G, Meyer DH, Chatzinikolaou G, Stratigi K, Garinis GA, Schumacher B.
The DREAM complex functions as conserved master regulator of somatic DNA-repair capacities.
Nat Struct Mol Biol 2023 30(4) 475-488 
[ PubMed ID = 36959262 ] [ RRC reference ]

Huang M, Hong M, Hou X, Zhu C, Chen D, Chen X, Guang S, Feng X.
H3K9me1/2 methylation limits the lifespan of daf-2 mutants in C. elegans.
Elife 2022 11  
[ PubMed ID = 36125117 ] [ RRC reference ]

Rodriguez-Crespo D, Nanchen M, Rajopadhye S, Wicky C.
The zinc-finger transcription factor LSL-1 is a major regulator of the germline transcriptional program in Caenorhabditis elegans.
Genetics 2022 221(1)  
[ PubMed ID = 35262739 ] [ RRC reference ]

Spichal M, Heestand B, Billmyre KK, Frenk S, Mello CC, Ahmed S.
Germ granule dysfunction is a hallmark and mirror of Piwi mutant sterility.
Nat Commun 2021 12(1) 1420 
[ PubMed ID = 33658512 ] [ RRC reference ]

Hsu TY, Zhang B, L'Etoile ND, Juang BT.
C. elegans orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity.
Elife 2021 10  
[ PubMed ID = 33646120 ] [ RRC reference ]

Fields BD, Kennedy S.
Chromatin Compaction by Small RNAs and the Nuclear RNAi Machinery in C. elegans.
Sci Rep 2019 9(1) 9030 
[ PubMed ID = 31227740 ] [ RRC reference ]

Rechtsteiner A, Costello ME, Egelhofer TA, Garrigues JM, Strome S, Petrella LN.
Repression of Germline Genes in Caenorhabditis elegans Somatic Tissues by H3K9 Dimethylation of Their Promoters.
Genetics 2019 212(1) 125-140 
[ PubMed ID = 30910798 ] [ RRC reference ]

Saldi TK, Gonzales P, Garrido-Lecca A, Dostal V, Roberts CM, Petrucelli L, Link CD.
The Caenorhabditis elegans Ortholog of TDP-43 Regulates the Chromatin Localization of the Heterochromatin Protein 1 Homolog HPL-2.
Mol Cell Biol 2018 38(15)  
[ PubMed ID = 29760282 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]

Lee CS, Lu T, Seydoux G.
Nanos promotes epigenetic reprograming of the germline by down-regulation of the THAP transcription factor LIN-15B.
Elife 2017 6  
[ PubMed ID = 29111977 ] [ RRC reference ]

Herbette M, Mercier MG, Michal F, Cluet D, Burny C, Yvert G, Robert VJ, Palladino F.
The C. elegans SET-2/SET1 histone H3 Lys4 (H3K4) methyltransferase preserves genome stability in the germline.
DNA Repair (Amst) 2017 57 139-150 
[ PubMed ID = 28779964 ] [ RRC reference ]

Patel T, Hobert O.
Coordinated control of terminal differentiation and restriction of cellular plasticity.
Elife 2017 6  
[ PubMed ID = 28422646 ] [ RRC reference ]

McMurchy AN, Stempor P, Gaarenstroom T, Wysolmerski B, Dong Y, Aussianikava D, Appert A, Huang N, Kolasinska-Zwierz P, Sapetschnig A, Miska EA, Ahringer J.
A team of heterochromatin factors collaborates with small RNA pathways to combat repetitive elements and germline stress.
Elife 2017 6  
[ PubMed ID = 28294943 ] [ RRC reference ]

Snyder MJ, Lau AC, Brouhard EA, Davis MB, Jiang J, Sifuentes MH, Csankovszki G.
Anchoring of Heterochromatin to the Nuclear Lamina Reinforces Dosage Compensation-Mediated Gene Repression.
PLoS Genet 2016 12(9) e1006341 
[ PubMed ID = 27690361 ] [ RRC reference ]

Vandamme J, Sidoli S, Mariani L, Friis C, Christensen J, Helin K, Jensen ON, Salcini AE.
H3K23me2 is a new heterochromatic mark in Caenorhabditis elegans.
Nucleic Acids Res 2015 43(20) 9694-710 
[ PubMed ID = 26476455 ] [ RRC reference ]

Mao H, Zhu C, Zong D, Weng C, Yang X, Huang H, Liu D, Feng X, Guang S.
The Nrde Pathway Mediates Small-RNA-Directed Histone H3 Lysine 27 Trimethylation in Caenorhabditis elegans.
Curr Biol 2015 25(18) 2398-403 
[ PubMed ID = 26365259 ] [ RRC reference ]

Garrigues JM, Sidoli S, Garcia BA, Strome S.
Defining heterochromatin in C. elegans through genome-wide analysis of the heterochromatin protein 1 homolog HPL-2.
Genome Res 2015 25(1) 76-88 
[ PubMed ID = 25467431 ] [ RRC reference ]

Juang BT, Ludwig AL, Benedetti KL, Gu C, Collins K, Morales C, Asundi A, Wittmann T, L'Etoile N, Hagerman PJ.
Expression of an expanded CGG-repeat RNA in a single pair of primary sensory neurons impairs olfactory adaptation in Caenorhabditis elegans.
Hum Mol Genet 2014 23(18) 4945-59 
[ PubMed ID = 24821701 ] [ RRC reference ]

Kozlowski L, Garvis S, Bedet C, Palladino F.
The Caenorhabditis elegans HP1 family protein HPL-2 maintains ER homeostasis through the UPR and hormesis.
Proc Natl Acad Sci U S A 2014 111(16) 5956-61 
[ PubMed ID = 24715729 ] [ RRC reference ]