Mutants (Isolated)

tm1489

Allele Nametm1489
Sequence NameK01G5.2a
CGC Namehpl-2
Worm BaseAllele Name tm1489
CGC Name hpl-2
Sequence K01G5.2a
Phenotypehomozygous viable. Dr. R.H. Horvitz: not completely penetrant multivulva and sterile at 25 degree, synthetic multivulva with mutations in class A, B and C genes. Dr. M. Han: WT at 20 degree, partial Muv at 25 degree. tm1489; lin-8 (null) is partial Muv at 20C, complete and obvious Muv at 25C. tm1489; lin-15A (RNAi) is Muv at 20C. Dr. W. Vermeulen: hpl-1 (tm1624) hpl-2 (tm1489) double mutant shows severe UV sensitivity.
Mutation site14347/14348-15019/15020 (672 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(13194..13266, 13966..14204, 14472..14645, 14920..14961))
Map position5.24
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCACTTATGTGCAGTACAG,ExtRev:TACATGCAACAAACCGCGCT,IntFwd:GTGCAGTACAGCCGGCATAT,IntRev:TCAGAGCTCCTAACCTACCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Coustham V, Bedet C, Monier K, Schott S, Karali M, Palladino F.
The C. elegans HP1 homologue HPL-2 and the LIN-13 zinc finger protein form a complex implicated in vulval development.
Dev. Biol. 2006 297(2) 308-22 
[ PubMed ID = 16890929 ] [ RRC reference ]

Andersen EC, Horvitz HR.
Two C. elegans histone methyltransferases repress lin-3 EGF transcription to inhibit vulval development.
Development 2007 134(16) 2991-9 
[ PubMed ID = 17634190 ] [ RRC reference ]

Kirienko NV, McEnerney JD, Fay DS.
Coordinated regulation of intestinal functions in C. elegans by LIN-35/Rb and SLR-2.
PLoS Genet. 2008 4(4) e1000059 
[ PubMed ID = 18437219 ] [ RRC reference ]

Schott S, Ramos F, Coustham V, Palladino F.
HPL-2/HP1 prevents inappropriate vulval induction in Caenorhabditis elegans by acting in both HYP7 and vulval precursor cells.
Genetics 2009 181(2) 797-801 
[ PubMed ID = 19064713 ] [ RRC reference ]

Herbette M, Mercier MG, Michal F, Cluet D, Burny C, Yvert G, Robert VJ, Palladino F.
The C. elegans SET-2/SET1 histone H3 Lys4 (H3K4) methyltransferase preserves genome stability in the germline.
DNA Repair (Amst.) 2017 57 139-150 
[ PubMed ID = 28779964 ] [ RRC reference ]

Lee CS, Lu T, Seydoux G.
Nanos promotes epigenetic reprograming of the germline by down-regulation of the THAP transcription factor LIN-15B.
Elife 2017 6  
[ PubMed ID = 29111977 ] [ RRC reference ]

Garrigues JM, Sidoli S, Garcia BA, Strome S.
Defining heterochromatin in C. elegans through genome-wide analysis of the heterochromatin protein 1 homolog HPL-2.
Genome Res. 2015 25(1) 76-88 
[ PubMed ID = 25467431 ] [ RRC reference ]

Juang BT, Ludwig AL, Benedetti KL, Gu C, Collins K, Morales C, Asundi A, Wittmann T, L'Etoile N, Hagerman PJ.
Expression of an expanded CGG-repeat RNA in a single pair of primary sensory neurons impairs olfactory adaptation in Caenorhabditis elegans.
Hum. Mol. Genet. 2014 23(18) 4945-59 
[ PubMed ID = 24821701 ] [ RRC reference ]

Petrella LN, Wang W, Spike CA, Rechtsteiner A, Reinke V, Strome S.
synMuv B proteins antagonize germline fate in the intestine and ensure C. elegans survival.
Development 2011 138(6) 1069-79 
[ PubMed ID = 21343362 ] [ RRC reference ]

Updike DL, Hachey SJ, Kreher J, Strome S.
P granules extend the nuclear pore complex environment in the C. elegans germ line.
J. Cell Biol. 2011 192(6) 939-48 
[ PubMed ID = 21402789 ] [ RRC reference ]

Andersen EC, Lu X, Horvitz HR.
C. elegans ISWI and NURF301 antagonize an Rb-like pathway in the determination of multiple cell fates.
Development 2006 133(14) 2695-704 
[ PubMed ID = 16774993 ] [ RRC reference ]

Schott S, Coustham V, Simonet T, Bedet C, Palladino F.
Unique and redundant functions of C. elegans HP1 proteins in post-embryonic development.
Dev. Biol. 2006 298(1) 176-87 
[ PubMed ID = 16905130 ] [ RRC reference ]

Simonet T, Dulermo R, Schott S, Palladino F.
Antagonistic functions of SET-2/SET1 and HPL/HP1 proteins in C. elegans development.
Dev. Biol. 2007 312(1) 367-83 
[ PubMed ID = 17967446 ] [ RRC reference ]

Luijsterburg MS, Dinant C, Lans H, Stap J, Wiernasz E, Lagerwerf S, Warmerdam DO, Lindh M, Brink MC, Dobrucki JW, Aten JA, Fousteri MI, Jansen G, Dantuma NP, Vermeulen W, Mullenders LH, Houtsmuller AB, Verschure PJ, van Driel R.
Heterochromatin protein 1 is recruited to various types of DNA damage.
J. Cell Biol. 2009 185(4) 577-86 
[ PubMed ID = 19451271 ] [ RRC reference ]

Saldi TK, Gonzales P, Garrido-Lecca A, Dostal V, Roberts CM, Petrucelli L, Link CD.
The Caenorhabditis elegans Ortholog of TDP-43 Regulates the Chromatin Localization of the Heterochromatin Protein 1 Homolog HPL-2.
Mol. Cell. Biol. 2018 38(15)  
[ PubMed ID = 29760282 ] [ RRC reference ]

Patel T, Hobert O.
Coordinated control of terminal differentiation and restriction of cellular plasticity.
Elife 2017 6  
[ PubMed ID = 28422646 ] [ RRC reference ]

Mao H, Zhu C, Zong D, Weng C, Yang X, Huang H, Liu D, Feng X, Guang S.
The Nrde Pathway Mediates Small-RNA-Directed Histone H3 Lysine 27 Trimethylation in Caenorhabditis elegans.
Curr. Biol. 2015 25(18) 2398-403 
[ PubMed ID = 26365259 ] [ RRC reference ]

Kozlowski L, Garvis S, Bedet C, Palladino F.
The Caenorhabditis elegans HP1 family protein HPL-2 maintains ER homeostasis through the UPR and hormesis.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(16) 5956-61 
[ PubMed ID = 24715729 ] [ RRC reference ]

Meister P, Schott S, Bedet C, Xiao Y, Rohner S, Bodennec S, Hudry B, Molin L, Solari F, Gasser SM, Palladino F.
Caenorhabditis elegans Heterochromatin protein 1 (HPL-2) links developmental plasticity, longevity and lipid metabolism.
Genome Biol. 2011 12(12) R123 
[ PubMed ID = 22185090 ] [ RRC reference ]

McNally KL, Fabritius AS, Ellefson ML, Flynn JR, Milan JA, McNally FJ.
Kinesin-1 prevents capture of the oocyte meiotic spindle by the sperm aster.
Dev. Cell 2012 22(4) 788-98 
[ PubMed ID = 22465668 ] [ RRC reference ]