Mutants (Isolated)

tm1489

Allele Nametm1489
Sequence NameK01G5.2a
CGC Namehpl-2
Worm BaseAllele Name tm1489
CGC Name hpl-2
Sequence K01G5.2a
Phenotypehomozygous viable. Dr. R.H. Horvitz: not completely penetrant multivulva and sterile at 25 degree, synthetic multivulva with mutations in class A, B and C genes. Dr. M. Han: WT at 20 degree, partial Muv at 25 degree. tm1489; lin-8 (null) is partial Muv at 20C, complete and obvious Muv at 25C. tm1489; lin-15A (RNAi) is Muv at 20C. Dr. W. Vermeulen: hpl-1 (tm1624) hpl-2 (tm1489) double mutant shows severe UV sensitivity.
Mutation site14347/14348-15019/15020 (672 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(13194..13266, 13966..14204, 14472..14645, 14920..14961))
Map position5.24
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCACTTATGTGCAGTACAG,ExtRev:TACATGCAACAAACCGCGCT,IntFwd:GTGCAGTACAGCCGGCATAT,IntRev:TCAGAGCTCCTAACCTACCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Herbette M, Mercier MG, Michal F, Cluet D, Burny C, Yvert G, Robert VJ, Palladino F.
The C. elegans SET-2/SET1 histone H3 Lys4 (H3K4) methyltransferase preserves genome stability in the germline.
DNA Repair (Amst.) 2017 57 139-150 
[ PubMed ID = 28779964 ] [ RRC reference ]

Lee CS, Lu T, Seydoux G.
Nanos promotes epigenetic reprograming of the germline by down-regulation of the THAP transcription factor LIN-15B.
Elife 2017 6  
[ PubMed ID = 29111977 ] [ RRC reference ]

Petrella LN, Wang W, Spike CA, Rechtsteiner A, Reinke V, Strome S.
synMuv B proteins antagonize germline fate in the intestine and ensure C. elegans survival.
Development 2011 138(6) 1069-79 
[ PubMed ID = 21343362 ] [ RRC reference ]

Updike DL, Hachey SJ, Kreher J, Strome S.
P granules extend the nuclear pore complex environment in the C. elegans germ line.
J. Cell Biol. 2011 192(6) 939-48 
[ PubMed ID = 21402789 ] [ RRC reference ]

Garrigues JM, Sidoli S, Garcia BA, Strome S.
Defining heterochromatin in C. elegans through genome-wide analysis of the heterochromatin protein 1 homolog HPL-2.
Genome Res. 2015 25(1) 76-88 
[ PubMed ID = 25467431 ] [ RRC reference ]

Juang BT, Ludwig AL, Benedetti KL, Gu C, Collins K, Morales C, Asundi A, Wittmann T, L'Etoile N, Hagerman PJ.
Expression of an expanded CGG-repeat RNA in a single pair of primary sensory neurons impairs olfactory adaptation in Caenorhabditis elegans.
Hum. Mol. Genet. 2014 23(18) 4945-59 
[ PubMed ID = 24821701 ] [ RRC reference ]

Coustham V, Bedet C, Monier K, Schott S, Karali M, Palladino F.
The C. elegans HP1 homologue HPL-2 and the LIN-13 zinc finger protein form a complex implicated in vulval development.
Dev. Biol. 2006 297(2) 308-22 
[ PubMed ID = 16890929 ] [ RRC reference ]

Andersen EC, Horvitz HR.
Two C. elegans histone methyltransferases repress lin-3 EGF transcription to inhibit vulval development.
Development 2007 134(16) 2991-9 
[ PubMed ID = 17634190 ] [ RRC reference ]

Kirienko NV, McEnerney JD, Fay DS.
Coordinated regulation of intestinal functions in C. elegans by LIN-35/Rb and SLR-2.
PLoS Genet. 2008 4(4) e1000059 
[ PubMed ID = 18437219 ] [ RRC reference ]

Schott S, Ramos F, Coustham V, Palladino F.
HPL-2/HP1 prevents inappropriate vulval induction in Caenorhabditis elegans by acting in both HYP7 and vulval precursor cells.
Genetics 2009 181(2) 797-801 
[ PubMed ID = 19064713 ] [ RRC reference ]

Patel T, Hobert O.
Coordinated control of terminal differentiation and restriction of cellular plasticity.
Elife 2017 6  
[ PubMed ID = 28422646 ] [ RRC reference ]

McNally KL, Fabritius AS, Ellefson ML, Flynn JR, Milan JA, McNally FJ.
Kinesin-1 prevents capture of the oocyte meiotic spindle by the sperm aster.
Dev. Cell 2012 22(4) 788-98 
[ PubMed ID = 22465668 ] [ RRC reference ]

Studencka M, Wesołowski R, Opitz L, Salinas-Riester G, Wisniewski JR, Jedrusik-Bode M.
Transcriptional repression of Hox genes by C. elegans HP1/HPL and H1/HIS-24.
PLoS Genet. 2012 8(9) e1002940 
[ PubMed ID = 23028351 ] [ RRC reference ]

Studencka M, Konzer A, Moneron G, Wenzel D, Opitz L, Salinas-Riester G, Bedet C, Krüger M, Hell SW, Wisniewski JR, Schmidt H, Palladino F, Schulze E, Jedrusik-Bode M.
Novel roles of Caenorhabditis elegans heterochromatin protein HP1 and linker histone in the regulation of innate immune gene expression.
Mol. Cell. Biol. 2012 32(2) 251-65 
[ PubMed ID = 22083954 ] [ RRC reference ]

Yuen KW, Nabeshima K, Oegema K, Desai A.
Rapid de novo centromere formation occurs independently of heterochromatin protein 1 in C. elegans embryos.
Curr. Biol. 2011 21(21) 1800-7 
[ PubMed ID = 22018540 ] [ RRC reference ]

Hall SE, Beverly M, Russ C, Nusbaum C, Sengupta P.
A cellular memory of developmental history generates phenotypic diversity in C. elegans.
Curr. Biol. 2010 20(2) 149-55 
[ PubMed ID = 20079644 ] [ RRC reference ]

Mao H, Zhu C, Zong D, Weng C, Yang X, Huang H, Liu D, Feng X, Guang S.
The Nrde Pathway Mediates Small-RNA-Directed Histone H3 Lysine 27 Trimethylation in Caenorhabditis elegans.
Curr. Biol. 2015 25(18) 2398-403 
[ PubMed ID = 26365259 ] [ RRC reference ]

Kozlowski L, Garvis S, Bedet C, Palladino F.
The Caenorhabditis elegans HP1 family protein HPL-2 maintains ER homeostasis through the UPR and hormesis.
Proc. Natl. Acad. Sci. U.S.A. 2014 111(16) 5956-61 
[ PubMed ID = 24715729 ] [ RRC reference ]

Meister P, Schott S, Bedet C, Xiao Y, Rohner S, Bodennec S, Hudry B, Molin L, Solari F, Gasser SM, Palladino F.
Caenorhabditis elegans Heterochromatin protein 1 (HPL-2) links developmental plasticity, longevity and lipid metabolism.
Genome Biol. 2011 12(12) R123 
[ PubMed ID = 22185090 ] [ RRC reference ]

Andersen EC, Lu X, Horvitz HR.
C. elegans ISWI and NURF301 antagonize an Rb-like pathway in the determination of multiple cell fates.
Development 2006 133(14) 2695-704 
[ PubMed ID = 16774993 ] [ RRC reference ]