Mutants (Isolated)

tm1489

Allele Nametm1489
Sequence NameK01G5.2a
CGC Namehpl-2
Worm BaseAllele Name tm1489
CGC Name hpl-2
Sequence K01G5.2a
Phenotypehomozygous viable. Dr. R.H. Horvitz: not completely penetrant multivulva and sterile at 25 degree, synthetic multivulva with mutations in class A, B and C genes. Dr. M. Han: WT at 20 degree, partial Muv at 25 degree. tm1489; lin-8 (null) is partial Muv at 20C, complete and obvious Muv at 25C. tm1489; lin-15A (RNAi) is Muv at 20C. Dr. W. Vermeulen: hpl-1 (tm1624) hpl-2 (tm1489) double mutant shows severe UV sensitivity.
Mutation site14347/14348-15019/15020 (672 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(13194..13266, 13966..14204, 14472..14645, 14920..14961))
Map position5.24
Balancer
Map position of balancer
Sequence of primersExtFwd:GGCACTTATGTGCAGTACAG,ExtRev:TACATGCAACAAACCGCGCT,IntFwd:GTGCAGTACAGCCGGCATAT,IntRev:TCAGAGCTCCTAACCTACCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hsu TY, Zhang B, L'Etoile ND, Juang BT.
C. elegans orthologs MUT-7/CeWRN-1 of Werner syndrome protein regulate neuronal plasticity.
Elife 2021 10  
[ PubMed ID = 33646120 ] [ RRC reference ]

Rechtsteiner A, Costello ME, Egelhofer TA, Garrigues JM, Strome S, Petrella LN.
Repression of Germline Genes in Caenorhabditis elegans Somatic Tissues by H3K9 Dimethylation of Their Promoters.
Genetics 2019 212(1) 125-140 
[ PubMed ID = 30910798 ] [ RRC reference ]

Fields BD, Kennedy S.
Chromatin Compaction by Small RNAs and the Nuclear RNAi Machinery in C. elegans.
Sci Rep 2019 9(1) 9030 
[ PubMed ID = 31227740 ] [ RRC reference ]

Lee CS, Lu T, Seydoux G.
Nanos promotes epigenetic reprograming of the germline by down-regulation of the THAP transcription factor LIN-15B.
Elife 2017 6  
[ PubMed ID = 29111977 ] [ RRC reference ]

Herbette M, Mercier MG, Michal F, Cluet D, Burny C, Yvert G, Robert VJ, Palladino F.
The C. elegans SET-2/SET1 histone H3 Lys4 (H3K4) methyltransferase preserves genome stability in the germline.
DNA Repair (Amst) 2017 57 139-150 
[ PubMed ID = 28779964 ] [ RRC reference ]

Saldi TK, Gonzales P, Garrido-Lecca A, Dostal V, Roberts CM, Petrucelli L, Link CD.
The Caenorhabditis elegans Ortholog of TDP-43 Regulates the Chromatin Localization of the Heterochromatin Protein 1 Homolog HPL-2.
Mol Cell Biol 2018 38(15)  
[ PubMed ID = 29760282 ] [ RRC reference ]

McMurchy AN, Stempor P, Gaarenstroom T, Wysolmerski B, Dong Y, Aussianikava D, Appert A, Huang N, Kolasinska-Zwierz P, Sapetschnig A, Miska EA, Ahringer J.
A team of heterochromatin factors collaborates with small RNA pathways to combat repetitive elements and germline stress.
Elife 2017 6  
[ PubMed ID = 28294943 ] [ RRC reference ]

Snyder MJ, Lau AC, Brouhard EA, Davis MB, Jiang J, Sifuentes MH, Csankovszki G.
Anchoring of Heterochromatin to the Nuclear Lamina Reinforces Dosage Compensation-Mediated Gene Repression.
PLoS Genet 2016 12(9) e1006341 
[ PubMed ID = 27690361 ] [ RRC reference ]

Updike DL, Hachey SJ, Kreher J, Strome S.
P granules extend the nuclear pore complex environment in the C. elegans germ line.
J Cell Biol 2011 192(6) 939-48 
[ PubMed ID = 21402789 ] [ RRC reference ]

Petrella LN, Wang W, Spike CA, Rechtsteiner A, Reinke V, Strome S.
synMuv B proteins antagonize germline fate in the intestine and ensure C. elegans survival.
Development 2011 138(6) 1069-79 
[ PubMed ID = 21343362 ] [ RRC reference ]

Patel T, Hobert O.
Coordinated control of terminal differentiation and restriction of cellular plasticity.
Elife 2017 6  
[ PubMed ID = 28422646 ] [ RRC reference ]

Juang BT, Ludwig AL, Benedetti KL, Gu C, Collins K, Morales C, Asundi A, Wittmann T, L'Etoile N, Hagerman PJ.
Expression of an expanded CGG-repeat RNA in a single pair of primary sensory neurons impairs olfactory adaptation in Caenorhabditis elegans.
Hum Mol Genet 2014 23(18) 4945-59 
[ PubMed ID = 24821701 ] [ RRC reference ]

Garrigues JM, Sidoli S, Garcia BA, Strome S.
Defining heterochromatin in C. elegans through genome-wide analysis of the heterochromatin protein 1 homolog HPL-2.
Genome Res 2015 25(1) 76-88 
[ PubMed ID = 25467431 ] [ RRC reference ]

Spichal M, Heestand B, Billmyre KK, Frenk S, Mello CC, Ahmed S.
Germ granule dysfunction is a hallmark and mirror of Piwi mutant sterility.
Nat Commun 2021 12(1) 1420 
[ PubMed ID = 33658512 ] [ RRC reference ]

Hall SE, Beverly M, Russ C, Nusbaum C, Sengupta P.
A cellular memory of developmental history generates phenotypic diversity in C. elegans.
Curr Biol 2010 20(2) 149-55 
[ PubMed ID = 20079644 ] [ RRC reference ]

Yuen KW, Nabeshima K, Oegema K, Desai A.
Rapid de novo centromere formation occurs independently of heterochromatin protein 1 in C. elegans embryos.
Curr Biol 2011 21(21) 1800-7 
[ PubMed ID = 22018540 ] [ RRC reference ]

Studencka M, Konzer A, Moneron G, Wenzel D, Opitz L, Salinas-Riester G, Bedet C, Krüger M, Hell SW, Wisniewski JR, Schmidt H, Palladino F, Schulze E, Jedrusik-Bode M.
Novel roles of Caenorhabditis elegans heterochromatin protein HP1 and linker histone in the regulation of innate immune gene expression.
Mol Cell Biol 2012 32(2) 251-65 
[ PubMed ID = 22083954 ] [ RRC reference ]

Studencka M, Wesołowski R, Opitz L, Salinas-Riester G, Wisniewski JR, Jedrusik-Bode M.
Transcriptional repression of Hox genes by C. elegans HP1/HPL and H1/HIS-24.
PLoS Genet 2012 8(9) e1002940 
[ PubMed ID = 23028351 ] [ RRC reference ]

McNally KL, Fabritius AS, Ellefson ML, Flynn JR, Milan JA, McNally FJ.
Kinesin-1 prevents capture of the oocyte meiotic spindle by the sperm aster.
Dev Cell 2012 22(4) 788-98 
[ PubMed ID = 22465668 ] [ RRC reference ]

Meister P, Schott S, Bedet C, Xiao Y, Rohner S, Bodennec S, Hudry B, Molin L, Solari F, Gasser SM, Palladino F.
Caenorhabditis elegans Heterochromatin protein 1 (HPL-2) links developmental plasticity, longevity and lipid metabolism.
Genome Biol 2011 12(12) R123 
[ PubMed ID = 22185090 ] [ RRC reference ]