Mutants (Isolated)

tm1472

Allele Nametm1472
BalanceNot Required
OutCrossNot Accepted
Sequence NameC53B7.4
Gene Nameasg-2
Worm BaseAllele Name tm1472
Gene Name asg-2
Sequence C53B7.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H-S. Koo: Gro, hypersensitive to oxidative stress, abnormal mitochondrial morphology. Dr. J. Hu: non-Unc, non-Dyf.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 831/832-T-1499/1500 (668 bp deletion + 1 bp insertion)
ChromosomeX
Putative gene structurejoin(1434..1538,1617..1736,1979..2071,2119..2196)
Map position-2.34
Balancer
Map position of balancer
Sequence of primersIntFwd:ATAAAGCAAGCTCCTCGCGT,ExtRev:GGGGACCAAGTTTACCCTTA,IntRev:TACTCCCCATGCATCTATGT,ExtFwd:CTGAGTTTGCGAGATCGCAT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Cooper JF, Nguyen K, Gates D, Wolfrum E, Capan C, Lee H, Williams D, Okoye C, Wojtovich AP, Burton NO.
Oocyte mitochondria link maternal environment to offspring phenotype.
Res Sq 2024   
[ PubMed ID = 38585755 ] [ RRC reference ]