分離済み変異体

tm1463

Allele Nametm1463
Allele Typeバランス済
Sequence NameF54D1.5
Gene Namegtl-2
Worm BaseAllele Name tm1463
Gene Name gtl-2
Sequence F54D1.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. Lihsia Chen: slow growing and sluggish, slightly Egl and constipated. Dr. Y. Jin: normal aldicarb sensitivity.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14788/14789-15251/15252 (463 bp deletion)
ChromosomeIV
Putative gene structurejoin(13600..13640, 13693..14154, 14550..14763, 14819..15081, 15133..15222, 15269..15485, 15749..15871, 15926..16012, 16058..16246, 16296..16513, 16556..16636, 16678..16839, 17121..17685, 17735..17923, 18923..19281, 19326..19397, 19445..19523, 19683..19728, 19781..19904, 19966..20023, 20077..20157, 20201..20271, 20323..20437, 20483..20571, 20617..20713)
Map position4.94
BalancernT1 [qIs51],tmC5[tmIs1220]
Map position of balancer
Sequence of primersExtFwd:AACACGCGGGTACACTAGCT,IntFwd:GTCCTAGGTTGAAGTGCCGT,ExtRev:CTGCTCATCAGGCGGCAAGT,IntRev:TCATCAGGCGGCAAGTTCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Otarigho B, Butts AF, Aballay A.
Neuronal NPR-15 modulates molecular and behavioral immune responses via the amphid sensory neuron-intestinal axis in C. elegans.
Elife 2024 12  
[ PubMed ID = 38446031 ] [ RRC reference ]

Filipowicz A, Lalsiamthara J, Aballay A.
TRPM channels mediate learned pathogen avoidance following intestinal distention.
Elife 2021 10  
[ PubMed ID = 34032213 ] [ RRC reference ]

Teramoto T, Sternick LA, Kage-Nakadai E, Sajjadi S, Siembida J, Mitani S, Iwasaki K, Lambie EJ.
Magnesium excretion in C. elegans requires the activity of the GTL-2 TRPM channel.
PLoS One 2010 5(3) e9589 
[ PubMed ID = 20221407 ] [ RRC reference ]

Xu S, Chisholm AD.
A Gαq-Ca²⁺ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans.
Curr Biol 2011 21(23) 1960-7 
[ PubMed ID = 22100061 ] [ RRC reference ]

Stawicki TM, Zhou K, Yochem J, Chen L, Jin Y.
TRPM channels modulate epileptic-like convulsions via systemic ion homeostasis.
Curr Biol 2011 21(10) 883-8 
[ PubMed ID = 21549603 ] [ RRC reference ]

Saur T, DeMarco SE, Ortiz A, Sliwoski GR, Hao L, Wang X, Cohen BM, Buttner EA.
A genome-wide RNAi screen in Caenorhabditis elegans identifies the nicotinic acetylcholine receptor subunit ACR-7 as an antipsychotic drug target.
PLoS Genet 2013 9(2) e1003313 
[ PubMed ID = 23468647 ] [ RRC reference ]

Wang X, Piccolo CW, Cohen BM, Buttner EA.
Transient receptor potential melastatin (TRPM) channels mediate clozapine-induced phenotypes in Caenorhabditis elegans.
J Neurogenet 2014 28(1-2) 86-97 
[ PubMed ID = 24564792 ] [ RRC reference ]

Xu S, Chisholm AD.
C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair.
Dev Cell 2014 31(1) 48-60 
[ PubMed ID = 25313960 ] [ RRC reference ]

Opperman K, Moseley-Alldredge M, Yochem J, Bell L, Kanayinkal T, Chen L.
A novel nondevelopmental role of the sax-7/L1CAM cell adhesion molecule in synaptic regulation in Caenorhabditis elegans.
Genetics 2015 199(2) 497-509 
[ PubMed ID = 25488979 ] [ RRC reference ]