Mutants (Isolated)

tm1463

Allele Name

tm1463

Sequence Name

F54D1.5

CGC Name

gtl-2

Worm Base

Allele Name

tm1463

CGC Name

gtl-2

Sequence

F54D1.5

Phenotype

lethal or sterile. Dr. Lihsia Chen: slow growing and sluggish, slightly Egl and constipated. Dr. Y. Jin: normal aldicarb sensitivity.

Mutation site

14788/14789-15251/15252 (463 bp deletion)

Chromosome

Putative gene structure

join(13600..13640, 13693..14154, 14550..14763, 14819..15081, 15133..15222, 15269..15485, 15749..15871, 15926..16012, 16058..16246, 16296..16513, 16556..16636, 16678..16839, 17121..17685, 17735..17923, 18923..19281, 19326..19397, 19445..19523, 19683..19728, 19781..19904, 19966..20023, 20077..20157, 20201..20271, 20323..20437, 20483..20571, 20617..20713)

Map position

4.94

Balancer

nT1 [qIs51]

Map position of balancer

Sequence of primers

ExtFwd:AACACGCGGGTACACTAGCT,IntFwd:GTCCTAGGTTGAAGTGCCGT,ExtRev:CTGCTCATCAGGCGGCAAGT,IntRev:TCATCAGGCGGCAAGTTCTG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Teramoto T, Sternick LA, Kage-Nakadai E, Sajjadi S, Siembida J, Mitani S, Iwasaki K, Lambie EJ.
Magnesium excretion in C. elegans requires the activity of the GTL-2 TRPM channel.
PLoS One 2010 5(3) e9589
[ PubMed ID = 20221407 ] [ RRC reference ]

Xu S, Chisholm AD.
A Gαq-Ca²⁺ signaling pathway promotes actin-mediated epidermal wound closure in C. elegans.
Curr Biol 2011 21(23) 1960-7
[ PubMed ID = 22100061 ] [ RRC reference ]

Stawicki TM, Zhou K, Yochem J, Chen L, Jin Y.
TRPM channels modulate epileptic-like convulsions via systemic ion homeostasis.
Curr Biol 2011 21(10) 883-8
[ PubMed ID = 21549603 ] [ RRC reference ]

Saur T, DeMarco SE, Ortiz A, Sliwoski GR, Hao L, Wang X, Cohen BM, Buttner EA.
A genome-wide RNAi screen in Caenorhabditis elegans identifies the nicotinic acetylcholine receptor subunit ACR-7 as an antipsychotic drug target.
PLoS Genet 2013 9(2) e1003313
[ PubMed ID = 23468647 ] [ RRC reference ]

Wang X, Piccolo CW, Cohen BM, Buttner EA.
Transient receptor potential melastatin (TRPM) channels mediate clozapine-induced phenotypes in Caenorhabditis elegans.
J Neurogenet 2014 28(1-2) 86-97
[ PubMed ID = 24564792 ] [ RRC reference ]

Xu S, Chisholm AD.
C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair.
Dev Cell 2014 31(1) 48-60
[ PubMed ID = 25313960 ] [ RRC reference ]

Opperman K, Moseley-Alldredge M, Yochem J, Bell L, Kanayinkal T, Chen L.
A novel nondevelopmental role of the sax-7/L1CAM cell adhesion molecule in synaptic regulation in Caenorhabditis elegans.
Genetics 2015 199(2) 497-509
[ PubMed ID = 25488979 ] [ RRC reference ]