分離済み変異体

tm14493

Allele Nametm14493
BalanceRequest Available
OutCrossRequest Available
Sequence NameC34D1.4 C34D1.5 F32F2 C26E1 C50B6.1 C50B6.2 C50B6.3 C50B6.4 C50B6.5 C50B6.6 C50B6.7 C50B6.13 C50B6.12 C50B6.14 C50B6.8
Gene NameC34D1.4 C34D1.5 F32F2 C26E1 C50B6.1 C50B6.2 C50B6.3 C50B6.4 C50B6.5 C50B6.6 C50B6.7 C50B6.13 C50B6.12 C50B6.14 C50B6.8
Worm BaseAllele Name tm14493
Gene Name C34D1.4 C34D1.5 F32F2 C26E1 C50B6.1 C50B6.2 C50B6.3 C50B6.4 C50B6.5 C50B6.6 C50B6.7 C50B6.13 C50B6.12 C50B6.14 C50B6.8
Sequence C34D1.4 C34D1.5 F32F2 C26E1 C50B6.1 C50B6.2 C50B6.3 C50B6.4 C50B6.5 C50B6.6 C50B6.7 C50B6.13 C50B6.12 C50B6.14 C50B6.8
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [C34D1]31364/31365-[C50B6]27359/27360(79535 bp deletion)
ChromosomeV
Putative gene structureC34D1.4 =complement(join(33234..33512, 34036..34299, 34354..34536, 35289..35448)); C34D1.5 =join(44587..44907, 44957..[F32F2]127, 378..443, 865..1037); F32F2 C26E1 C50B6.1 =join(1513..1639, 1685..1765, 1825..1941, 1994..2020); C50B6.2 =complement(join(2783..3651, 3698..4050, 4106..4395, 4445..4857)); C50B6.3 =join(6170..6268, 6321..6483, 6532..7116, 7207..7971, 8025..8418); C50B6.4 =complement(join(9624..10406, 10454..10608)); C50B6.5 =join(11049..11221, 11307..11452, 11897..12333, 12385..12463, 12511..12822); C50B6.6 =join(13581..13654, 13709..13834, 13884..14029, 14076..14272, 14327..14642, 14708..14952); C50B6.7 =complement(join(14962..15502, 15568..15753, 15799..15902, 15954..16171, 16221..16634, 16680..16871, 16918..17122, 17227..17580)); C50B6.13 =join(18936..19660, 19706..20067, 20120..20231); C50B6.12 =join(20360..20914, 20985..21354, 21399..21463); C50B6.14 =complement(join(21789..22139, 22186..22292, 22337..22543, 22600..22709, 22753..23096, 23141..23330, 23564..23616));C50B6.8 =complement(join(23711..24086, 24446..24552, 24601..24902, 24948..25562, 25921..25990, 26154..26468))
Map position5.16
Balancer
Map position of balancer
Sequence of primersExtRev:CGGCTTTGATACTAAACGTC,ExtFwd:GCAACCGGTAATCAACGAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication