分離済み変異体

tm1447

Allele Nametm1447
BalanceNot Required
OutCrossNot Accepted
Sequence NameY116A8C.12
Gene Namearf-6
Worm BaseAllele Name tm1447
Gene Name arf-6
Sequence Y116A8C.12
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Han: WT vulval development, slow growth and WT touch response. Dr. K. Shen: Normal HSN vulval presynaptic vesicle clusters (unc-86::SNB-1::YFP), no obvious egg laying defects. Dr. Y. Jin: no specific neuronal phenotype is found. Dr. C. Rongo: normal GLR-1::GFP localization and expression. Dr. J-L. Bessereau: no specific neuronal phenotype. Dr. G. Garriga: extra AVM/PVM in arf-1: arf-6 double mutants. Dr. O. Blacque: dye-filling normal. Dr. J. Lee: normal touch response.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 46750/46751-49013/49014 (2263 bp deletion)
ChromosomeIV
Putative gene structurejoin(47037..47118, 47186..47289, 47380..47477, 47561..47661, 47882..47942, 49289..49370)
Map position15.8
Balancer
Map position of balancer
Sequence of primersExtRev:GTCTCCGGTTGAAGCACATG,IntRev:GGTTGGACGTACCTGCAAAG,ExtFwd:CTAGGAGATTACAGGCCCAT,IntFwd:CGCAAAAACGAATGCGTAGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Wang Y, Arnold ML, Smart AJ, Wang G, Androwski RJ, Morera A, Nguyen KCQ, Schweinsberg PJ, Bai G, Cooper J, Hall DH, Driscoll M, Grant BD.
Large vesicle extrusions from C. elegans neurons are consumed and stimulated by glial-like phagocytosis activity of the neighboring cell.
Elife 2023 12  
[ PubMed ID = 36861960 ] [ RRC reference ]

Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705 
[ PubMed ID = 38239833 ] [ RRC reference ]

Wang X, Li X, Wang J, Wang J, Hu C, Zeng J, Shi A, Lin L.
SMGL-1/NBAS acts as a RAB-8 GEF to regulate unconventional protein secretion.
J Cell Biol 2022 221(7)  
[ PubMed ID = 35604368 ] [ RRC reference ]

Baltaci O, Pedersen ME, Sherry T, Handley A, Snieckute G, Cao W, Haas M, Archer S, Pocock R.
Atypical TGF-β signaling controls neuronal guidance in Caenorhabditis elegans.
iScience 2022 25(2) 103791 
[ PubMed ID = 35146399 ] [ RRC reference ]

Chen D, Xu W, Wang Y, Ye Y, Wang Y, Yu M, Gao J, Wei J, Dong Y, Zhang H, Fu X, Ma K, Wang H, Yang Z, Zhou J, Cheng W, Wang S, Chen J, Grant BD, Myers CL, Shi A, Xia T.
Revealing Functional Crosstalk between Distinct Bioprocesses through Reciprocal Functional Tests of Genetically Interacting Genes.
Cell Rep 2019 29(9) 2646-2658.e5 
[ PubMed ID = 31775035 ] [ RRC reference ]

Richardson CE, Yee C, Shen K.
A hormone receptor pathway cell-autonomously delays neuron morphological aging by suppressing endocytosis.
PLoS Biol 2019 17(10) e3000452 
[ PubMed ID = 31589601 ] [ RRC reference ]

Chen D, Yang C, Liu S, Hang W, Wang X, Chen J, Shi A.
SAC-1 ensures epithelial endocytic recycling by restricting ARF-6 activity.
J Cell Biol 2018 217(6) 2121-2139 
[ PubMed ID = 29563216 ] [ RRC reference ]

Gong T, Yan Y, Zhang J, Liu S, Liu H, Gao J, Zhou X, Chen J, Shi A.
PTRN-1/CAMSAP promotes CYK-1/formin-dependent actin polymerization during endocytic recycling.
EMBO J 2018 37(9)  
[ PubMed ID = 29567645 ] [ RRC reference ]

Liu H, Wang S, Hang W, Gao J, Zhang W, Cheng Z, Yang C, He J, Zhou J, Chen J, Shi A.
LET-413/Erbin acts as a RAB-5 effector to promote RAB-10 activation during endocytic recycling.
J Cell Biol 2018 217(1) 299-314 
[ PubMed ID = 29079669 ] [ RRC reference ]

Imae R, Dejima K, Kage-Nakadai E, Arai H, Mitani S.
Endomembrane-associated RSD-3 is important for RNAi induced by extracellular silencing RNA in both somatic and germ cells of Caenorhabditis elegans.
Sci Rep 2016 6 28198 
[ PubMed ID = 27306325 ] [ RRC reference ]

Wang P, Liu H, Wang Y, Liu O, Zhang J, Gleason A, Yang Z, Wang H, Shi A, Grant BD.
RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes.
PLoS Genet 2016 12(6) e1006093 
[ PubMed ID = 27272733 ] [ RRC reference ]

Wang P, Liu H, Wang Y, Liu O, Zhang J, Gleason A, Yang Z, Wang H, Shi A, Grant BD.
RAB-10 Promotes EHBP-1 Bridging of Filamentous Actin and Tubular Recycling Endosomes.
PLoS Genet 2016 12(6) e1006093 
[ PubMed ID = 27272733 ] [ RRC reference ]

Zhai J, Zhang L, Mojsilovic-Petrovic J, Jian X, Thomas J, Homma K, Schmitz A, Famulok M, Ichijo H, Argon Y, Randazzo PA, Kalb RG.
Inhibition of Cytohesins Protects against Genetic Models of Motor Neuron Disease.
J Neurosci 2015 35(24) 9088-105 
[ PubMed ID = 26085633 ] [ RRC reference ]

Skorobogata O, Escobar-Restrepo JM, Rocheleau CE.
An AGEF-1/Arf GTPase/AP-1 ensemble antagonizes LET-23 EGFR basolateral localization and signaling during C. elegans vulva induction.
PLoS Genet 2014 10(10) e1004728 
[ PubMed ID = 25329472 ] [ RRC reference ]

Teuliere J, Cordes S, Singhvi A, Talavera K, Garriga G.
Asymmetric neuroblast divisions producing apoptotic cells require the cytohesin GRP-1 in Caenorhabditis elegans.
Genetics 2014 198(1) 229-47 
[ PubMed ID = 25053664 ] [ RRC reference ]

Gleason RJ, Akintobi AM, Grant BD, Padgett RW.
BMP signaling requires retromer-dependent recycling of the type I receptor.
Proc Natl Acad Sci U S A 2014 111(7) 2578-83 
[ PubMed ID = 24550286 ] [ RRC reference ]

Shi A, Liu O, Koenig S, Banerjee R, Chen CC, Eimer S, Grant BD.
RAB-10-GTPase-mediated regulation of endosomal phosphatidylinositol-4,5-bisphosphate.
Proc Natl Acad Sci U S A 2012 109(35) E2306-15 
[ PubMed ID = 22869721 ] [ RRC reference ]

Kimata T, Tanizawa Y, Can Y, Ikeda S, Kuhara A, Mori I.
Synaptic polarity depends on phosphatidylinositol signaling regulated by myo-inositol monophosphatase in Caenorhabditis elegans.
Genetics 2012 191(2) 509-21 
[ PubMed ID = 22446320 ] [ RRC reference ]

Singhvi A, Teuliere J, Talavera K, Cordes S, Ou G, Vale RD, Prasad BC, Clark SG, Garriga G.
The Arf GAP CNT-2 regulates the apoptotic fate in C. elegans asymmetric neuroblast divisions.
Curr Biol 2011 21(11) 948-54 
[ PubMed ID = 21596567 ] [ RRC reference ]