Home > Mutants (Isolated) > tm1436

Mutants (Isolated)

Allele Name		tm1436
Allele Type		Balanced
Sequence Name		W10D5.2
Gene Name		nduf-7
Worm Base	Allele Name	tm1436
	Gene Name	nduf-7
	Sequence	W10D5.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		lethal or sterile. Dr. S. van den Heuvel: Ste
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		20580/20581-21279/21280 (699 bp deletion)
Chromosome		I
Putative gene structure		complement(join(19372..19449, 20341..20556, 20845..21044, 21436..21541))
Map position		3.58
Balancer		hT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primers		ExtFwd:GCGCGATTACATCATGCCGT,IntFwd:CCGTCCTTAGCCCACCATTC,ExtRev:CAGTCGGTACTCGCCGTCTT,IntRev:CGCCGTCTTGCTTCGACTCA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Meisel JD, Miranda M, Skinner OS, Wiesenthal PP, Wellner SM, Jourdain AA, Ruvkun G, Mootha VK. Hypoxia and intra-complex genetic suppressors rescue complex I mutants by a shared mechanism. Cell 2024 187(3) 659-675.e18  [ PubMed ID = 38215760 ] [ RRC reference ] Rauthan M, Ranji P, Abukar R, Pilon M. A Mutation in Caenorhabditis elegans NDUF-7 Activates the Mitochondrial Stress Response and Prolongs Lifespan via ROS and CED-4. G3 (Bethesda) 2015 5(8) 1639-48  [ PubMed ID = 26038366 ] [ RRC reference ]