Home > Mutants (Isolated) > tm14261

Mutants (Isolated)

tm14261

Allele Nametm14261
BalanceCompleted
OutCrossCompleted
Sequence NameR04F11.2 R04F11.4 R04F11.t1 F23H12 K01D12.1 K01D12.3 K01D12.15 K01D12.4 K01D12.5 K01D12.6 K01D12.20 K01D12.7 K01D12.8 K01D12.9 K01D12.10 K01D12.11
Gene NameR04F11.2 R04F11.4 R04F11.t1 F23H12 K01D12.1 K01D12.3 K01D12.15 K01D12.4 K01D12.5 K01D12.6 K01D12.20 K01D12.7 K01D12.8 K01D12.9 K01D12.10 K01D12.11
Worm BaseAllele Name tm14261 (x1)
Gene Name R04F11.2 R04F11.4 R04F11.t1 F23H12 K01D12.1 K01D12.3 K01D12.15 K01D12.4 K01D12.5 K01D12.6 K01D12.20 K01D12.7 K01D12.8 K01D12.9 K01D12.10 K01D12.11
Sequence R04F11.2 R04F11.4 R04F11.t1 F23H12 K01D12.1 K01D12.3 K01D12.15 K01D12.4 K01D12.5 K01D12.6 K01D12.20 K01D12.7 K01D12.8 K01D12.9 K01D12.10 K01D12.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [R04F11]10726/10727-T-[K01D12]31625/31626(89221 bp deletion + 1 bp insertion)
ChromosomeV
Putative gene structureR04F11.2 =join(10400..10439, 10642..10756, 10939..11078, 11942..12208); R04F11.4 =complement(join(12202..12683, 12749..13109, 13935..14027, 14074..14169, 14381..14515, 15080..15352, 15402..15518, 16483..16625, 16681..16823, 17150..17233, 18482..18590, 24092..24132)); R04F11.t1 =complement(23980..24052); F23H12 K01D12.1 =join(1249..1318, 1365..1564, 1640..1828, 1874..2015, 2129..2525); K01D12.3 =join(4947..4980, 5027..5260, 8079..8399, 8466..8585, 8629..8697, 8747..8888, 8932..9316); K01D12.15 =join(9979..10033, 10136..10458); K01D12.4 =complement(join(10734..11195, 11254..11444, 11518..11592, 11643..11801, 11987..12085, 12159..12481, 13776..13919, 14219..14323)); K01D12.5 =join(21538..22227, 22273..22476); K01D12.6 =complement(join(22452..22801, 22850..23341, 23437..23753, 23798..24207, 24280..24377, 24429..24552)); K01D12.20 =complement(24460..24507); K01D12.7 =complement(join(24911..25187, 25473..25587)); K01D12.8 =join26348..26471, 26543..26927); K01D12.9 =complement(join(27635..28057, 28212..28344)); K01D12.10 =join(29922..30027, 30071..30625, 30672..30710); K01D12.11 =complement(join(31121..31281, 31326..31581, 31689..31756, 31810..31932, 31977..32108, 32157..32285))
Map position
BalancertmC12[tmIs1194]
Map position of balancer
Sequence of primersExtRev:CGAGATTCGTTTGAGACAAC,ExtFwd:ATAACGCAGGTCTCGCTTCG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication