Mutants (Isolated)

tm1425

Allele Nametm1425
Sequence NameT26E3.3
CGC Namepar-6
Worm BaseAllele Name tm1425
CGC Name par-6
Sequence T26E3.3
Phenotypelethal or sterile. Dr. J. Nance: Development 134, 1259 (2007).
Mutation site14515/14516-15368/15369 (853 bp deletion)
ChromosomeI
Putative gene structurejoin(14400..14533, 15066..15159, 16090..16281, 17131..17228, 17298..17418, 17469..17562, 18623..18819)
Map position13.9
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:AACGCGGAGCTGCACCTGTA,IntFwd:CCTACAACGGCTCCTACCAT,ExtRev:CTGTGAGACCCATTACCTGT,IntRev:TTCACCGCGGCGTTGAATGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Li J, Kim H, Aceto DG, Hung J, Aono S, Kemphues KJ.
Binding to PKC-3, but not to PAR-3 or to a conventional PDZ domain ligand, is required for PAR-6 function in C. elegans.
Dev. Biol. 2010 340(1) 88-98 
[ PubMed ID = 20122916 ] [ RRC reference ]

Von Stetina SE, Liang J, Marnellos G, Mango SE.
Temporal regulation of epithelium formation mediated by FoxA, MKLP1, MgcRacGAP, and PAR-6.
Mol. Biol. Cell 2017 28(15) 2042-2065 
[ PubMed ID = 28539408 ] [ RRC reference ]

Zilberman Y, Abrams J, Anderson DC, Nance J.
Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis.
J. Cell Biol. 2017 216(11) 3729-3744 
[ PubMed ID = 28903999 ] [ RRC reference ]

Totong R, Achilleos A, Nance J.
PAR-6 is required for junction formation but not apicobasal polarization in C. elegans embryonic epithelial cells.
Development 2007 134(7) 1259-68 
[ PubMed ID = 17314130 ] [ RRC reference ]

Goehring NW, Trong PK, Bois JS, Chowdhury D, Nicola EM, Hyman AA, Grill SW.
Polarization of PAR proteins by advective triggering of a pattern-forming system.
Science 2011 334(6059) 1137-41 
[ PubMed ID = 22021673 ] [ RRC reference ]

Von Stetina SE, Mango SE.
PAR-6, but not E-cadherin and β-integrin, is necessary for epithelial polarization in C. elegans.
Dev. Biol. 2015 403(1) 5-14 
[ PubMed ID = 25773364 ] [ RRC reference ]

Feldman JL, Priess JR.
A role for the centrosome and PAR-3 in the hand-off of MTOC function during epithelial polarization.
Curr. Biol. 2012 22(7) 575-82 
[ PubMed ID = 22425160 ] [ RRC reference ]

Zhang H, Abraham N, Khan LA, Hall DH, Fleming JT, Göbel V.
Apicobasal domain identities of expanding tubular membranes depend on glycosphingolipid biosynthesis.
Nat. Cell Biol. 2011 13(10) 1189-201 
[ PubMed ID = 21926990 ] [ RRC reference ]

Achilleos A, Wehman AM, Nance J.
PAR-3 mediates the initial clustering and apical localization of junction and polarity proteins during C. elegans intestinal epithelial cell polarization.
Development 2010 137(11) 1833-42 
[ PubMed ID = 20431121 ] [ RRC reference ]

Zhang H, Kim A, Abraham N, Khan LA, Hall DH, Fleming JT, Gobel V.
Clathrin and AP-1 regulate apical polarity and lumen formation during C. elegans tubulogenesis.
Development 2012 139(11) 2071-83 
[ PubMed ID = 22535410 ] [ RRC reference ]