Mutants (Isolated)

tm1425

Allele Nametm1425
BalanceCompleted
OutCrossNot Accepted
Sequence NameT26E3.3
Gene Namepar-6
Worm BaseAllele Name tm1425 (x1)
Gene Name par-6
Sequence T26E3.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. J. Nance: Development 134, 1259 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 14515/14516-15368/15369 (853 bp deletion)
ChromosomeI
Putative gene structurejoin(14400..14533, 15066..15159, 16090..16281, 17131..17228, 17298..17418, 17469..17562, 18623..18819)
Map position13.9
Balancer,tmC27[tmIs1239]
Map position of balancer
Sequence of primersExtFwd:AACGCGGAGCTGCACCTGTA,IntFwd:CCTACAACGGCTCCTACCAT,ExtRev:CTGTGAGACCCATTACCTGT,IntRev:TTCACCGCGGCGTTGAATGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Rodrigues NTL, Bland T, Ng K, Hirani N, Goehring NW.
Quantitative perturbation-phenotype maps reveal nonlinear responses underlying robustness of PAR-dependent asymmetric cell division.
PLoS Biol 2024 22(12) e3002437 
[ PubMed ID = 39652540 ] [ RRC reference ]

Ow MC, Nichitean AM, Hall SE.
Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans.
Elife 2021 10  
[ PubMed ID = 34236316 ] [ RRC reference ]

Fan L, Kovacevic I, Heiman MG, Bao Z.
A multicellular rosette-mediated collective dendrite extension.
Elife 2019 8  
[ PubMed ID = 30767892 ] [ RRC reference ]

Zilberman Y, Abrams J, Anderson DC, Nance J.
Cdc42 regulates junctional actin but not cell polarization in the Caenorhabditis elegans epidermis.
J Cell Biol 2017 216(11) 3729-3744 
[ PubMed ID = 28903999 ] [ RRC reference ]

Von Stetina SE, Liang J, Marnellos G, Mango SE.
Temporal regulation of epithelium formation mediated by FoxA, MKLP1, MgcRacGAP, and PAR-6.
Mol Biol Cell 2017 28(15) 2042-2065 
[ PubMed ID = 28539408 ] [ RRC reference ]

Lee KS, Iwanir S, Kopito RB, Scholz M, Calarco JA, Biron D, Levine E.
Serotonin-dependent kinetics of feeding bursts underlie a graded response to food availability in C. elegans.
Nat Commun 2017 8 14221 
[ PubMed ID = 28145493 ] [ RRC reference ]

Walck-Shannon E, Lucas B, Chin-Sang I, Reiner D, Kumfer K, Cochran H, Bothfeld W, Hardin J.
CDC-42 Orients Cell Migration during Epithelial Intercalation in the Caenorhabditis elegans Epidermis.
PLoS Genet 2016 12(11) e1006415 
[ PubMed ID = 27861585 ] [ RRC reference ]

Von Stetina SE, Mango SE.
PAR-6, but not E-cadherin and β-integrin, is necessary for epithelial polarization in C. elegans.
Dev Biol 2015 403(1) 5-14 
[ PubMed ID = 25773364 ] [ RRC reference ]

Zhang H, Kim A, Abraham N, Khan LA, Hall DH, Fleming JT, Gobel V.
Clathrin and AP-1 regulate apical polarity and lumen formation during C. elegans tubulogenesis.
Development 2012 139(11) 2071-83 
[ PubMed ID = 22535410 ] [ RRC reference ]

Feldman JL, Priess JR.
A role for the centrosome and PAR-3 in the hand-off of MTOC function during epithelial polarization.
Curr Biol 2012 22(7) 575-82 
[ PubMed ID = 22425160 ] [ RRC reference ]

Goehring NW, Trong PK, Bois JS, Chowdhury D, Nicola EM, Hyman AA, Grill SW.
Polarization of PAR proteins by advective triggering of a pattern-forming system.
Science 2011 334(6059) 1137-41 
[ PubMed ID = 22021673 ] [ RRC reference ]

Zhang H, Abraham N, Khan LA, Hall DH, Fleming JT, Göbel V.
Apicobasal domain identities of expanding tubular membranes depend on glycosphingolipid biosynthesis.
Nat Cell Biol 2011 13(10) 1189-201 
[ PubMed ID = 21926990 ] [ RRC reference ]

Achilleos A, Wehman AM, Nance J.
PAR-3 mediates the initial clustering and apical localization of junction and polarity proteins during C. elegans intestinal epithelial cell polarization.
Development 2010 137(11) 1833-42 
[ PubMed ID = 20431121 ] [ RRC reference ]

Li J, Kim H, Aceto DG, Hung J, Aono S, Kemphues KJ.
Binding to PKC-3, but not to PAR-3 or to a conventional PDZ domain ligand, is required for PAR-6 function in C. elegans.
Dev Biol 2010 340(1) 88-98 
[ PubMed ID = 20122916 ] [ RRC reference ]

Totong R, Achilleos A, Nance J.
PAR-6 is required for junction formation but not apicobasal polarization in C. elegans embryonic epithelial cells.
Development 2007 134(7) 1259-68 
[ PubMed ID = 17314130 ] [ RRC reference ]