分離済み変異体

tm1411

Allele Nametm1411
BalanceCompleted
OutCrossNot Accepted
Sequence NameF33D11.11
Gene NameF33D11.11
Worm BaseAllele Name tm1411 (x1)
Gene Name F33D11.11
Sequence F33D11.11
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. A. Chisholm: maternal effect Let, morphogenesis defects.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 36170/36171-ATATGTATATA-36827/36828 (657 bp deletion + 11 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(35659..35787, 35874..36021, 36113..36398, 36557..36731))
Map position0.47
BalancerhT2,hT2 [bli-4(e937) let-? qIs48]
Map position of balancer
Sequence of primersExtFwd:ACTCCGAGATAATACGGCGA,IntFwd:TTGGGGGAACGGGGAACCAT,ExtRev:ACGCTTGCCTCTAGGCACTA,IntRev:TAGGCACTAAGCACTGGCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cottee PA, Cole T, Schultz J, Hoang HD, Vibbert J, Han SM, Miller MA.
The C. elegans VAPB homolog VPR-1 is a permissive signal for gonad development.
Development 2017 144(12) 2187-2199 
[ PubMed ID = 28634273 ] [ RRC reference ]

Schultz J, Lee SJ, Cole T, Hoang HD, Vibbert J, Cottee PA, Miller MA, Han SM.
The secreted MSP domain of C. elegans VAPB homolog VPR-1 patterns the adult striated muscle mitochondrial reticulum via SMN-1.
Development 2017 144(12) 2175-2186 
[ PubMed ID = 28634272 ] [ RRC reference ]

Walck-Shannon E, Lucas B, Chin-Sang I, Reiner D, Kumfer K, Cochran H, Bothfeld W, Hardin J.
CDC-42 Orients Cell Migration during Epithelial Intercalation in the Caenorhabditis elegans Epidermis.
PLoS Genet 2016 12(11) e1006415 
[ PubMed ID = 27861585 ] [ RRC reference ]

Han SM, El Oussini H, Scekic-Zahirovic J, Vibbert J, Cottee P, Prasain JK, Bellen HJ, Dupuis L, Miller MA.
VAPB/ALS8 MSP ligands regulate striated muscle energy metabolism critical for adult survival in caenorhabditis elegans.
PLoS Genet 2013 9(9) e1003738 
[ PubMed ID = 24039594 ] [ RRC reference ]

Han SM, Tsuda H, Yang Y, Vibbert J, Cottee P, Lee SJ, Winek J, Haueter C, Bellen HJ, Miller MA.
Secreted VAPB/ALS8 major sperm protein domains modulate mitochondrial localization and morphology via growth cone guidance receptors.
Dev Cell 2012 22(2) 348-62 
[ PubMed ID = 22264801 ] [ RRC reference ]

Tsuda H, Han SM, Yang Y, Tong C, Lin YQ, Mohan K, Haueter C, Zoghbi A, Harati Y, Kwan J, Miller MA, Bellen HJ.
The amyotrophic lateral sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors.
Cell 2008 133(6) 963-77 
[ PubMed ID = 18555774 ] [ RRC reference ]