Mutants (Isolated)

tm1411

Allele Nametm1411
Sequence NameF33D11.11
CGC NameF33D11.11
Worm BaseAllele Name tm1411
CGC Name F33D11.11
Sequence F33D11.11
Phenotypelethal or sterile. Dr. A. Chisholm: maternal effect Let, morphogenesis defects.
Mutation site36170/36171-ATATGTATATA-36827/36828 (657 bp deletion + 11 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(35659..35787, 35874..36021, 36113..36398, 36557..36731))
Map position0.47
BalancerhT2
Map position of balancer
Sequence of primersExtFwd:ACTCCGAGATAATACGGCGA,IntFwd:TTGGGGGAACGGGGAACCAT,ExtRev:ACGCTTGCCTCTAGGCACTA,IntRev:TAGGCACTAAGCACTGGCCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cottee PA, Cole T, Schultz J, Hoang HD, Vibbert J, Han SM, Miller MA.
The C. elegans VAPB homolog VPR-1 is a permissive signal for gonad development.
Development 2017 144(12) 2187-2199 
[ PubMed ID = 28634273 ] [ RRC reference ]

Walck-Shannon E, Lucas B, Chin-Sang I, Reiner D, Kumfer K, Cochran H, Bothfeld W, Hardin J.
CDC-42 Orients Cell Migration during Epithelial Intercalation in the Caenorhabditis elegans Epidermis.
PLoS Genet 2016 12(11) e1006415 
[ PubMed ID = 27861585 ] [ RRC reference ]

Schultz J, Lee SJ, Cole T, Hoang HD, Vibbert J, Cottee PA, Miller MA, Han SM.
The secreted MSP domain of C. elegans VAPB homolog VPR-1 patterns the adult striated muscle mitochondrial reticulum via SMN-1.
Development 2017 144(12) 2175-2186 
[ PubMed ID = 28634272 ] [ RRC reference ]

Han SM, El Oussini H, Scekic-Zahirovic J, Vibbert J, Cottee P, Prasain JK, Bellen HJ, Dupuis L, Miller MA.
VAPB/ALS8 MSP ligands regulate striated muscle energy metabolism critical for adult survival in caenorhabditis elegans.
PLoS Genet 2013 9(9) e1003738 
[ PubMed ID = 24039594 ] [ RRC reference ]

Han SM, Tsuda H, Yang Y, Vibbert J, Cottee P, Lee SJ, Winek J, Haueter C, Bellen HJ, Miller MA.
Secreted VAPB/ALS8 major sperm protein domains modulate mitochondrial localization and morphology via growth cone guidance receptors.
Dev Cell 2012 22(2) 348-62 
[ PubMed ID = 22264801 ] [ RRC reference ]

Tsuda H, Han SM, Yang Y, Tong C, Lin YQ, Mohan K, Haueter C, Zoghbi A, Harati Y, Kwan J, Miller MA, Bellen HJ.
The amyotrophic lateral sclerosis 8 protein VAPB is cleaved, secreted, and acts as a ligand for Eph receptors.
Cell 2008 133(6) 963-77 
[ PubMed ID = 18555774 ] [ RRC reference ]