Mutants (Isolated)

tm1400

Allele Nametm1400
Sequence NameF57C2.3
CGC Namepot-2
Worm BaseAllele Name tm1400
CGC Name pot-2
Sequence F57C2.3
Phenotypehomozygous viable. Dr. J. Lee: increased telomere length.
Mutation site5930/5931-6258/6259 (328 bp deletion)
ChromosomeII
Putative gene structurejoin(5796..6140, 6186..6433, 6485..6647)
Map position23.06
Balancer
Map position of balancer
Sequence of primersIntFwd:GCGCGTCGTATGTAACGCAT,ExtFwd:CTTGTTTGCGCGTCGTATGT,IntRev:TTGATATGATGCTCCGCCAC,ExtRev:TCTGGCTGTTGGAACTCGGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Cook DE, Zdraljevic S, Tanny RE, Seo B, Riccardi DD, Noble LM, Rockman MV, Alkema MJ, Braendle C, Kammenga JE, Wang J, Kruglyak L, FĂ©lix MA, Lee J, Andersen EC.
The Genetic Basis of Natural Variation in Caenorhabditis elegans Telomere Length.
Genetics 2016 204(1) 371-83 
[ PubMed ID = 27449056 ] [ RRC reference ]

Seo B, Kim C, Hills M, Sung S, Kim H, Kim E, Lim DS, Oh HS, Choi RMJ, Chun J, Shim J, Lee J.
Telomere maintenance through recruitment of internal genomic regions.
Nat Commun 2015 6 8189 
[ PubMed ID = 26382656 ] [ RRC reference ]

Shtessel L, Lowden MR, Cheng C, Simon M, Wang K, Ahmed S.
Caenorhabditis elegans POT-1 and POT-2 repress telomere maintenance pathways.
G3 (Bethesda) 2013 3(2) 305-13 
[ PubMed ID = 23390606 ] [ RRC reference ]

Ferreira HC, Towbin BD, Jegou T, Gasser SM.
The shelterin protein POT-1 anchors Caenorhabditis elegans telomeres through SUN-1 at the nuclear periphery.
J Cell Biol 2013 203(5) 727-35 
[ PubMed ID = 24297748 ] [ RRC reference ]

Cheng C, Shtessel L, Brady MM, Ahmed S.
Caenorhabditis elegans POT-2 telomere protein represses a mode of alternative lengthening of telomeres with normal telomere lengths.
Proc Natl Acad Sci U S A 2012 109(20) 7805-10 
[ PubMed ID = 22547822 ] [ RRC reference ]

Raices M, Verdun RE, Compton SA, Haggblom CI, Griffith JD, Dillin A, Karlseder J.
C. elegans telomeres contain G-strand and C-strand overhangs that are bound by distinct proteins.
Cell 2008 132(5) 745-57 
[ PubMed ID = 18329362 ] [ RRC reference ]