Mutants (Isolated)

tm1395

Allele Nametm1395
Sequence NameY71F9B.7
CGC Nameplk-2
Worm BaseAllele Name tm1395
CGC Name plk-2
Sequence Y71F9B.7
Phenotypehomozygous viable. Dr. M. Zetka: high incidence of embryonic lethality and mild Him. Dr. J. Kaplan: weak hypersensitivity to aldicarb, not GLR::GFP phenotype. Dr. A. Dernburg: ~65% embryonic inviability, Him.
Mutation site55179/55180-55539/55540 (360 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(54227..54529, 54576..55019, 55068..55502, 55793..55905, 55954..56245, 56302..56613))
Map position-7.27
Balancer
Map position of balancer
Sequence of primersIntFwd:CAGGCGATTGATACGAGTCT,ExtFwd:GCCAGCAGTGTCCAGCATGA,IntRev:GGCCCATAAACACAGCTGAC,ExtRev:GTTCGGACTACCGTACCCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Labella S, Woglar A, Jantsch V, Zetka M.
Polo kinases establish links between meiotic chromosomes and cytoskeletal forces essential for homolog pairing.
Dev. Cell 2011 21(5) 948-58 
[ PubMed ID = 22018921 ] [ RRC reference ]

Harper NC, Rillo R, Jover-Gil S, Assaf ZJ, Bhalla N, Dernburg AF.
Pairing centers recruit a Polo-like kinase to orchestrate meiotic chromosome dynamics in C. elegans.
Dev. Cell 2011 21(5) 934-47 
[ PubMed ID = 22018922 ] [ RRC reference ]

Gottschalk A, Almedom RB, Schedletzky T, Anderson SD, Yates JR 3rd, Schafer WR.
Identification and characterization of novel nicotinic receptor-associated proteins in Caenorhabditis elegans.
EMBO J. 2005 24(14) 2566-78 
[ PubMed ID = 15990870 ] [ RRC reference ]

Ferrandiz N, Barroso C, Telecan O, Shao N, Kim HM, Testori S, Faull P, Cutillas P, Snijders AP, Colaiácovo MP, Martinez-Perez E.
Spatiotemporal regulation of Aurora B recruitment ensures release of cohesion during C. elegans oocyte meiosis.
Nat Commun 2018 9(1) 834 
[ PubMed ID = 29483514 ] [ RRC reference ]

Link J, Paouneskou D, Velkova M, Daryabeigi A, Laos T, Labella S, Barroso C, Pacheco Piñol S, Montoya A, Kramer H, Woglar A, Baudrimont A, Markert SM, Stigloher C, Martinez-Perez E, Dammermann A, Alsheimer M, Zetka M, Jantsch V.
Transient and Partial Nuclear Lamina Disruption Promotes Chromosome Movement in Early Meiotic Prophase.
Dev. Cell 2018 45(2) 212-225.e7 
[ PubMed ID = 29689196 ] [ RRC reference ]

Kim Y, Kostow N, Dernburg AF.
The Chromosome Axis Mediates Feedback Control of CHK-2 to Ensure Crossover Formation in C. elegans.
Dev. Cell 2015 35(2) 247-61 
[ PubMed ID = 26506311 ] [ RRC reference ]