Mutants (Isolated)

tm1395

Allele Nametm1395
BalanceNot Required
OutCrossNot Accepted
Sequence NameY71F9B.7
Gene Nameplk-2
Worm BaseAllele Name tm1395
Gene Name plk-2
Sequence Y71F9B.7
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. M. Zetka: high incidence of embryonic lethality and mild Him. Dr. J. Kaplan: weak hypersensitivity to aldicarb, not GLR::GFP phenotype. Dr. A. Dernburg: ~65% embryonic inviability, Him.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 55179/55180-55539/55540 (360 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(54227..54529, 54576..55019, 55068..55502, 55793..55905, 55954..56245, 56302..56613))
Map position-7.27
Balancer
Map position of balancer
Sequence of primersIntFwd:CAGGCGATTGATACGAGTCT,ExtFwd:GCCAGCAGTGTCCAGCATGA,IntRev:GGCCCATAAACACAGCTGAC,ExtRev:GTTCGGACTACCGTACCCAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Gold AL, Hurlock ME, Guevara AM, Isenberg LYZ, Kim Y.
Identification of the Polo-like kinase substrate required for homologous synapsis.
J Cell Biol 2025 224(3)  
[ PubMed ID = 39680026 ] [ RRC reference ]

Brandt JN, Hussey KA, Kim Y.
Spatial and temporal control of targeting Polo-like kinase during meiotic prophase.
J Cell Biol 2020 219(11)  
[ PubMed ID = 32997737 ] [ RRC reference ]

Link J, Paouneskou D, Velkova M, Daryabeigi A, Laos T, Labella S, Barroso C, Pacheco Piñol S, Montoya A, Kramer H, Woglar A, Baudrimont A, Markert SM, Stigloher C, Martinez-Perez E, Dammermann A, Alsheimer M, Zetka M, Jantsch V.
Transient and Partial Nuclear Lamina Disruption Promotes Chromosome Movement in Early Meiotic Prophase.
Dev Cell 2018 45(2) 212-225.e7 
[ PubMed ID = 29689196 ] [ RRC reference ]

Ferrandiz N, Barroso C, Telecan O, Shao N, Kim HM, Testori S, Faull P, Cutillas P, Snijders AP, Colaiácovo MP, Martinez-Perez E.
Spatiotemporal regulation of Aurora B recruitment ensures release of cohesion during C. elegans oocyte meiosis.
Nat Commun 2018 9(1) 834 
[ PubMed ID = 29483514 ] [ RRC reference ]

Kim Y, Kostow N, Dernburg AF.
The Chromosome Axis Mediates Feedback Control of CHK-2 to Ensure Crossover Formation in C. elegans.
Dev Cell 2015 35(2) 247-61 
[ PubMed ID = 26506311 ] [ RRC reference ]

Harper NC, Rillo R, Jover-Gil S, Assaf ZJ, Bhalla N, Dernburg AF.
Pairing centers recruit a Polo-like kinase to orchestrate meiotic chromosome dynamics in C. elegans.
Dev Cell 2011 21(5) 934-47 
[ PubMed ID = 22018922 ] [ RRC reference ]

Labella S, Woglar A, Jantsch V, Zetka M.
Polo kinases establish links between meiotic chromosomes and cytoskeletal forces essential for homolog pairing.
Dev Cell 2011 21(5) 948-58 
[ PubMed ID = 22018921 ] [ RRC reference ]

Gottschalk A, Almedom RB, Schedletzky T, Anderson SD, Yates JR 3rd, Schafer WR.
Identification and characterization of novel nicotinic receptor-associated proteins in Caenorhabditis elegans.
EMBO J 2005 24(14) 2566-78 
[ PubMed ID = 15990870 ] [ RRC reference ]