Mutants (Isolated)

tm1380

Allele Nametm1380
Allele TypeNormal
Sequence NameT05H10.5
Gene Nameufd-2
Worm BaseAllele Name tm1380
Gene Name ufd-2
Sequence T05H10.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. T. Ogura: Genes to Cells: 12, 1063 (2007). Dr. R. Baumeister: Dev. Biol. 312, 193 (2007). Dr. T. Hoppe: Nat. Cell Biol. 9, 379 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 21052/21053-21967/21968 (915 bp deletion)
ChromosomeII
Putative gene structurejoin(20407..20463, 20518..20832, 20878..21799, 21850..22759, 22808..23162, 23215..23598)
Map position0.66
Balancer
Map position of balancer
Sequence of primersExtRev:CTGTGTTGTCCCATTCGACT,IntFwd:GTGATGCTTCTGTGGTGCGT,ExtFwd:AGGCTTGCAGCCGATGGACA,IntRev:GAATGAACTCTGCTCCGCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Das A, Thapa P, Santiago U, Shanmugam N, Banasiak K, Dąbrowska K, Nolte H, Szulc NA, Gathungu RM, Cysewski D, Krüger M, Dadlez M, Nowotny M, Camacho CJ, Hoppe T, Pokrzywa W.
A heterotypic assembly mechanism regulates CHIP E3 ligase activity.
EMBO J 2022 41(15) e109566 
[ PubMed ID = 35762422 ] [ RRC reference ]

Snoznik C, Medvedeva V, Mojsilovic-Petrovic J, Rudich P, Oosten J, Kalb RG, Lamitina T.
The nuclear ubiquitin ligase adaptor SPOP is a conserved regulator of C9orf72 dipeptide toxicity.
Proc Natl Acad Sci U S A 2021 118(40)  
[ PubMed ID = 34593637 ] [ RRC reference ]

Ackermann L, Schell M, Pokrzywa W, Kevei É, Gartner A, Schumacher B, Hoppe T.
E4 ligase-specific ubiquitination hubs coordinate DNA double-strand-break repair and apoptosis.
Nat Struct Mol Biol 2016 23(11) 995-1002 
[ PubMed ID = 27669035 ] [ RRC reference ]

Hellerschmied D, Roessler M, Lehner A, Gazda L, Stejskal K, Imre R, Mechtler K, Dammermann A, Clausen T.
UFD-2 is an adaptor-assisted E3 ligase targeting unfolded proteins.
Nat Commun 2018 9(1) 484 
[ PubMed ID = 29396393 ] [ RRC reference ]

Tawo R, Pokrzywa W, Kevei É, Akyuz ME, Balaji V, Adrian S, Höhfeld J, Hoppe T.
The Ubiquitin Ligase CHIP Integrates Proteostasis and Aging by Regulation of Insulin Receptor Turnover.
Cell 2017 169(3) 470-482.e13 
[ PubMed ID = 28431247 ] [ RRC reference ]

Kuhlbrodt K, Janiesch PC, Kevei É, Segref A, Barikbin R, Hoppe T.
The Machado-Joseph disease deubiquitylase ATX-3 couples longevity and proteostasis.
Nat Cell Biol 2011 13(3) 273-81 
[ PubMed ID = 21317884 ] [ RRC reference ]

Segref A, Torres S, Hoppe T.
A screenable in vivo assay to study proteostasis networks in Caenorhabditis elegans.
Genetics 2011 187(4) 1235-40 
[ PubMed ID = 21288877 ] [ RRC reference ]

Liu G, Rogers J, Murphy CT, Rongo C.
EGF signalling activates the ubiquitin proteasome system to modulate C. elegans lifespan.
EMBO J 2011 30(15) 2990-3003 
[ PubMed ID = 21673654 ] [ RRC reference ]

Murayama Y, Ogura T, Yamanaka K.
Characterization of C-terminal adaptors, UFD-2 and UFD-3, of CDC-48 on the polyglutamine aggregation in C. elegans.
Biochem Biophys Res Commun 2015 459(1) 154-60 
[ PubMed ID = 25721663 ] [ RRC reference ]

Crook-McMahon HM, Oláhová M, Button EL, Winter JJ, Veal EA.
Genome-wide screening identifies new genes required for stress-induced phase 2 detoxification gene expression in animals.
BMC Biol 2014 12 64 
[ PubMed ID = 25204677 ] [ RRC reference ]

Periz G, Lu J, Zhang T, Kankel MW, Jablonski AM, Kalb R, McCampbell A, Wang J.
Regulation of protein quality control by UBE4B and LSD1 through p53-mediated transcription.
PLoS Biol 2015 13(4) e1002114 
[ PubMed ID = 25837623 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J Neurosci 2015 35(42) 14286-306 
[ PubMed ID = 26490867 ] [ RRC reference ]

Nyamsuren O, Faggionato D, Loch W, Schulze E, Baumeister R.
A mutation in CHN-1/CHIP suppresses muscle degeneration in Caenorhabditis elegans.
Dev Biol 2007 312(1) 193-202 
[ PubMed ID = 17961535 ] [ RRC reference ]

Janiesch PC, Kim J, Mouysset J, Barikbin R, Lochmüller H, Cassata G, Krause S, Hoppe T.
The ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human myopathy.
Nat Cell Biol 2007 9(4) 379-90 
[ PubMed ID = 17369820 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Ogura T.
ER E3 ubiquitin ligase HRD-1 and its specific partner chaperone BiP play important roles in ERAD and developmental growth in Caenorhabditis elegans.
Genes Cells 2007 12(9) 1063-73 
[ PubMed ID = 17825049 ] [ RRC reference ]

O'Rourke SM, Dorfman MD, Carter JC, Bowerman B.
Dynein modifiers in C. elegans: light chains suppress conditional heavy chain mutants.
PLoS Genet 2007 3(8) e128 
[ PubMed ID = 17676955 ] [ RRC reference ]