Mutants (Isolated)

tm1380

Allele Nametm1380
Sequence NameT05H10.5
CGC Nameufd-2
Worm BaseAllele Name tm1380
CGC Name ufd-2
Sequence T05H10.5
Phenotypehomozygous viable. Dr. T. Ogura: Genes to Cells: 12, 1063 (2007). Dr. R. Baumeister: Dev. Biol. 312, 193 (2007). Dr. T. Hoppe: Nat. Cell Biol. 9, 379 (2007).
Mutation site21052/21053-21967/21968 (915 bp deletion)
ChromosomeII
Putative gene structurejoin(20407..20463, 20518..20832, 20878..21799, 21850..22759, 22808..23162, 23215..23598)
Map position0.66
Balancer
Map position of balancer
Sequence of primersExtRev:CTGTGTTGTCCCATTCGACT,IntFwd:GTGATGCTTCTGTGGTGCGT,ExtFwd:AGGCTTGCAGCCGATGGACA,IntRev:GAATGAACTCTGCTCCGCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Hellerschmied D, Roessler M, Lehner A, Gazda L, Stejskal K, Imre R, Mechtler K, Dammermann A, Clausen T.
UFD-2 is an adaptor-assisted E3 ligase targeting unfolded proteins.
Nat Commun 2018 9(1) 484 
[ PubMed ID = 29396393 ] [ RRC reference ]

Periz G, Lu J, Zhang T, Kankel MW, Jablonski AM, Kalb R, McCampbell A, Wang J.
Regulation of protein quality control by UBE4B and LSD1 through p53-mediated transcription.
PLoS Biol. 2015 13(4) e1002114 
[ PubMed ID = 25837623 ] [ RRC reference ]

O'Rourke SM, Dorfman MD, Carter JC, Bowerman B.
Dynein modifiers in C. elegans: light chains suppress conditional heavy chain mutants.
PLoS Genet. 2007 3(8) e128 
[ PubMed ID = 17676955 ] [ RRC reference ]

Nyamsuren O, Faggionato D, Loch W, Schulze E, Baumeister R.
A mutation in CHN-1/CHIP suppresses muscle degeneration in Caenorhabditis elegans.
Dev. Biol. 2007 312(1) 193-202 
[ PubMed ID = 17961535 ] [ RRC reference ]

Tawo R, Pokrzywa W, Kevei É, Akyuz ME, Balaji V, Adrian S, Höhfeld J, Hoppe T.
The Ubiquitin Ligase CHIP Integrates Proteostasis and Aging by Regulation of Insulin Receptor Turnover.
Cell 2017 169(3) 470-482.e13 
[ PubMed ID = 28431247 ] [ RRC reference ]

Crook-McMahon HM, Oláhová M, Button EL, Winter JJ, Veal EA.
Genome-wide screening identifies new genes required for stress-induced phase 2 detoxification gene expression in animals.
BMC Biol. 2014 12 64 
[ PubMed ID = 25204677 ] [ RRC reference ]

Murayama Y, Ogura T, Yamanaka K.
Characterization of C-terminal adaptors, UFD-2 and UFD-3, of CDC-48 on the polyglutamine aggregation in C. elegans.
Biochem. Biophys. Res. Commun. 2015 459(1) 154-60 
[ PubMed ID = 25721663 ] [ RRC reference ]

Liu G, Rogers J, Murphy CT, Rongo C.
EGF signalling activates the ubiquitin proteasome system to modulate C. elegans lifespan.
EMBO J. 2011 30(15) 2990-3003 
[ PubMed ID = 21673654 ] [ RRC reference ]

Janiesch PC, Kim J, Mouysset J, Barikbin R, Lochmüller H, Cassata G, Krause S, Hoppe T.
The ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human myopathy.
Nat. Cell Biol. 2007 9(4) 379-90 
[ PubMed ID = 17369820 ] [ RRC reference ]

Segref A, Torres S, Hoppe T.
A screenable in vivo assay to study proteostasis networks in Caenorhabditis elegans.
Genetics 2011 187(4) 1235-40 
[ PubMed ID = 21288877 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Ogura T.
ER E3 ubiquitin ligase HRD-1 and its specific partner chaperone BiP play important roles in ERAD and developmental growth in Caenorhabditis elegans.
Genes Cells 2007 12(9) 1063-73 
[ PubMed ID = 17825049 ] [ RRC reference ]

Kuhlbrodt K, Janiesch PC, Kevei É, Segref A, Barikbin R, Hoppe T.
The Machado-Joseph disease deubiquitylase ATX-3 couples longevity and proteostasis.
Nat. Cell Biol. 2011 13(3) 273-81 
[ PubMed ID = 21317884 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J. Neurosci. 2015 35(42) 14286-306 
[ PubMed ID = 26490867 ] [ RRC reference ]