分離済み変異体

tm1380

Allele Name

tm1380

Allele Type

通常株

Sequence Name

T05H10.5

Gene Name

ufd-2

Worm Base

Allele Name

tm1380

Gene Name

ufd-2

Sequence

T05H10.5

Phenotype

homozygous viable. Dr. T. Ogura: Genes to Cells: 12, 1063 (2007). Dr. R. Baumeister: Dev. Biol. 312, 193 (2007). Dr. T. Hoppe: Nat. Cell Biol. 9, 379 (2007).

Mutation site

21052/21053-21967/21968 (915 bp deletion)

Chromosome

Putative gene structure

join(20407..20463, 20518..20832, 20878..21799, 21850..22759, 22808..23162, 23215..23598)

Map position

0.66

Balancer

Map position of balancer

Sequence of primers

ExtRev:CTGTGTTGTCCCATTCGACT,IntFwd:GTGATGCTTCTGTGGTGCGT,ExtFwd:AGGCTTGCAGCCGATGGACA,IntRev:GAATGAACTCTGCTCCGCAT

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705
[ PubMed ID = 38239833 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Das A, Thapa P, Santiago U, Shanmugam N, Banasiak K, Dąbrowska K, Nolte H, Szulc NA, Gathungu RM, Cysewski D, Krüger M, Dadlez M, Nowotny M, Camacho CJ, Hoppe T, Pokrzywa W.
A heterotypic assembly mechanism regulates CHIP E3 ligase activity.
EMBO J 2022 41(15) e109566
[ PubMed ID = 35762422 ] [ RRC reference ]

Snoznik C, Medvedeva V, Mojsilovic-Petrovic J, Rudich P, Oosten J, Kalb RG, Lamitina T.
The nuclear ubiquitin ligase adaptor SPOP is a conserved regulator of C9orf72 dipeptide toxicity.
Proc Natl Acad Sci U S A 2021 118(40)
[ PubMed ID = 34593637 ] [ RRC reference ]

Ackermann L, Schell M, Pokrzywa W, Kevei É, Gartner A, Schumacher B, Hoppe T.
E4 ligase-specific ubiquitination hubs coordinate DNA double-strand-break repair and apoptosis.
Nat Struct Mol Biol 2016 23(11) 995-1002
[ PubMed ID = 27669035 ] [ RRC reference ]

Hellerschmied D, Roessler M, Lehner A, Gazda L, Stejskal K, Imre R, Mechtler K, Dammermann A, Clausen T.
UFD-2 is an adaptor-assisted E3 ligase targeting unfolded proteins.
Nat Commun 2018 9(1) 484
[ PubMed ID = 29396393 ] [ RRC reference ]

Tawo R, Pokrzywa W, Kevei É, Akyuz ME, Balaji V, Adrian S, Höhfeld J, Hoppe T.
The Ubiquitin Ligase CHIP Integrates Proteostasis and Aging by Regulation of Insulin Receptor Turnover.
Cell 2017 169(3) 470-482.e13
[ PubMed ID = 28431247 ] [ RRC reference ]

Kuhlbrodt K, Janiesch PC, Kevei É, Segref A, Barikbin R, Hoppe T.
The Machado-Joseph disease deubiquitylase ATX-3 couples longevity and proteostasis.
Nat Cell Biol 2011 13(3) 273-81
[ PubMed ID = 21317884 ] [ RRC reference ]

Segref A, Torres S, Hoppe T.
A screenable in vivo assay to study proteostasis networks in Caenorhabditis elegans.
Genetics 2011 187(4) 1235-40
[ PubMed ID = 21288877 ] [ RRC reference ]

Liu G, Rogers J, Murphy CT, Rongo C.
EGF signalling activates the ubiquitin proteasome system to modulate C. elegans lifespan.
EMBO J 2011 30(15) 2990-3003
[ PubMed ID = 21673654 ] [ RRC reference ]

Murayama Y, Ogura T, Yamanaka K.
Characterization of C-terminal adaptors, UFD-2 and UFD-3, of CDC-48 on the polyglutamine aggregation in C. elegans.
Biochem Biophys Res Commun 2015 459(1) 154-60
[ PubMed ID = 25721663 ] [ RRC reference ]

Crook-McMahon HM, Oláhová M, Button EL, Winter JJ, Veal EA.
Genome-wide screening identifies new genes required for stress-induced phase 2 detoxification gene expression in animals.
BMC Biol 2014 12 64
[ PubMed ID = 25204677 ] [ RRC reference ]

Periz G, Lu J, Zhang T, Kankel MW, Jablonski AM, Kalb R, McCampbell A, Wang J.
Regulation of protein quality control by UBE4B and LSD1 through p53-mediated transcription.
PLoS Biol 2015 13(4) e1002114
[ PubMed ID = 25837623 ] [ RRC reference ]

Jablonski AM, Lamitina T, Liachko NF, Sabatella M, Lu J, Zhang L, Ostrow LW, Gupta P, Wu CY, Doshi S, Mojsilovic-Petrovic J, Lans H, Wang J, Kraemer B, Kalb RG.
Loss of RAD-23 Protects Against Models of Motor Neuron Disease by Enhancing Mutant Protein Clearance.
J Neurosci 2015 35(42) 14286-306
[ PubMed ID = 26490867 ] [ RRC reference ]

Nyamsuren O, Faggionato D, Loch W, Schulze E, Baumeister R.
A mutation in CHN-1/CHIP suppresses muscle degeneration in Caenorhabditis elegans.
Dev Biol 2007 312(1) 193-202
[ PubMed ID = 17961535 ] [ RRC reference ]

Janiesch PC, Kim J, Mouysset J, Barikbin R, Lochmüller H, Cassata G, Krause S, Hoppe T.
The ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human myopathy.
Nat Cell Biol 2007 9(4) 379-90
[ PubMed ID = 17369820 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Ogura T.
ER E3 ubiquitin ligase HRD-1 and its specific partner chaperone BiP play important roles in ERAD and developmental growth in Caenorhabditis elegans.
Genes Cells 2007 12(9) 1063-73
[ PubMed ID = 17825049 ] [ RRC reference ]

O'Rourke SM, Dorfman MD, Carter JC, Bowerman B.
Dynein modifiers in C. elegans: light chains suppress conditional heavy chain mutants.
PLoS Genet 2007 3(8) e128
[ PubMed ID = 17676955 ] [ RRC reference ]