| Allele Name | tm1374 |
| Sequence Name | R06C1.1 |
| CGC Name | hda-3 |
| Worm Base | Allele Name |
tm1374
|
| CGC Name |
hda-3
|
| Sequence |
R06C1.1
|
| Phenotype | homozygous viable. Dr. J. Satterlee: suppress Huntington Q150 neuronal degenration in ASH neurons. Dr. W.G. Kelly: viable and exhibit a slight decrease in fertility and slight Egl. |
| Mutation site | 2082/2083-2506/2507 (424 bp deletion) |
| Chromosome | I |
| Putative gene structure | complement(join(4106..4264, 2394..2868, 1211..1411, 210..350, Z81108.1:7131..7552)) |
| Map position | 13 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | IntRev:CCCGTGCTTCATTCTCCGAA,ExtFwd:TAAAGGCGCACAGCCGGGTT,ExtRev:TCCCGCCCGTGCTTCATTCT,IntFwd:ACTTAAAGGCGCACAGACGA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Bates EA, Victor M, Jones AK, Shi Y, Hart AC.
Differential contributions of Caenorhabditis elegans histone deacetylases to huntingtin polyglutamine toxicity.
J Neurosci 2006 26(10) 2830-8
[ PubMed ID = 16525063 ]
[ RRC reference ]
|
Grote P, Conradt B.
The PLZF-like protein TRA-4 cooperates with the Gli-like transcription factor TRA-1 to promote female development in C. elegans.
Dev Cell 2006 11(4) 561-73
[ PubMed ID = 17011494 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.