Mutants (Isolated)

tm1374

Allele Nametm1374
Sequence NameR06C1.1
CGC Namehda-3
Worm BaseAllele Name tm1374
CGC Name hda-3
Sequence R06C1.1
Phenotypehomozygous viable. Dr. J. Satterlee: suppress Huntington Q150 neuronal degenration in ASH neurons. Dr. W.G. Kelly: viable and exhibit a slight decrease in fertility and slight Egl.
Mutation site2082/2083-2506/2507 (424 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(4106..4264, 2394..2868, 1211..1411, 210..350, Z81108.1:7131..7552))
Map position13
Balancer
Map position of balancer
Sequence of primersIntRev:CCCGTGCTTCATTCTCCGAA,ExtFwd:TAAAGGCGCACAGCCGGGTT,ExtRev:TCCCGCCCGTGCTTCATTCT,IntFwd:ACTTAAAGGCGCACAGACGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Bates EA, Victor M, Jones AK, Shi Y, Hart AC.
Differential contributions of Caenorhabditis elegans histone deacetylases to huntingtin polyglutamine toxicity.
J. Neurosci. 2006 26(10) 2830-8 
[ PubMed ID = 16525063 ] [ RRC reference ]

Grote P, Conradt B.
The PLZF-like protein TRA-4 cooperates with the Gli-like transcription factor TRA-1 to promote female development in C. elegans.
Dev. Cell 2006 11(4) 561-73 
[ PubMed ID = 17011494 ] [ RRC reference ]