分離済み変異体

tm1374

Allele Nametm1374
BalanceNot Required
OutCrossNot Accepted
Sequence NameR06C1.1
Gene Namehda-3
Worm BaseAllele Name tm1374
Gene Name hda-3
Sequence R06C1.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. J. Satterlee: suppress Huntington Q150 neuronal degenration in ASH neurons. Dr. W.G. Kelly: viable and exhibit a slight decrease in fertility and slight Egl.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2082/2083-2506/2507 (424 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(4106..4264, 2394..2868, 1211..1411, 210..350, Z81108.1:7131..7552))
Map position13
Balancer
Map position of balancer
Sequence of primersIntRev:CCCGTGCTTCATTCTCCGAA,ExtFwd:TAAAGGCGCACAGCCGGGTT,ExtRev:TCCCGCCCGTGCTTCATTCT,IntFwd:ACTTAAAGGCGCACAGACGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Grote P, Conradt B.
The PLZF-like protein TRA-4 cooperates with the Gli-like transcription factor TRA-1 to promote female development in C. elegans.
Dev Cell 2006 11(4) 561-73 
[ PubMed ID = 17011494 ] [ RRC reference ]

Bates EA, Victor M, Jones AK, Shi Y, Hart AC.
Differential contributions of Caenorhabditis elegans histone deacetylases to huntingtin polyglutamine toxicity.
J Neurosci 2006 26(10) 2830-8 
[ PubMed ID = 16525063 ] [ RRC reference ]