Home > Mutants (Isolated) > tm1374

Mutants (Isolated)

Allele Name		tm1374
Balance		Not Required
OutCross		Not Accepted
Sequence Name		R06C1.1
Gene Name		hda-3
Worm Base	Allele Name	tm1374
	Gene Name	hda-3
	Sequence	R06C1.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype"		homozygous viable. Dr. J. Satterlee: suppress Huntington Q150 neuronal degenration in ASH neurons. Dr. W.G. Kelly: viable and exhibit a slight decrease in fertility and slight Egl.
Mutation site Please see gene structure to locate the deletion in relation to exon(s)		2082/2083-2506/2507 (424 bp deletion)
Chromosome		I
Putative gene structure		complement(join(4106..4264, 2394..2868, 1211..1411, 210..350, Z81108.1:7131..7552))
Map position		13
Balancer
Map position of balancer
Sequence of primers		IntRev:CCCGTGCTTCATTCTCCGAA,ExtFwd:TAAAGGCGCACAGCCGGGTT,ExtRev:TCCCGCCCGTGCTTCATTCT,IntFwd:ACTTAAAGGCGCACAGACGA
Distributed lab
Depositor		Dr. S. Mitani/NBRP
References		Please submit your publication Grote P, Conradt B. The PLZF-like protein TRA-4 cooperates with the Gli-like transcription factor TRA-1 to promote female development in C. elegans. Dev Cell 2006 11(4) 561-73  [ PubMed ID = 17011494 ] [ RRC reference ] Bates EA, Victor M, Jones AK, Shi Y, Hart AC. Differential contributions of Caenorhabditis elegans histone deacetylases to huntingtin polyglutamine toxicity. J Neurosci 2006 26(10) 2830-8  [ PubMed ID = 16525063 ] [ RRC reference ]