Mutants (Isolated)

tm1359

Allele Nametm1359
Sequence NameY44E3B.1
CGC Namezip-4
Worm BaseAllele Name tm1359
CGC Name zip-4
Sequence Y44E3B.1
Phenotypehomozygous viable. Dr. Y. Jin: no movement phenotype, grows well.
Mutation site3582/3583-3979/3980 (397 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(3375..3447, 3500..4257, 4699..4824))
Map position-4.16
Balancer
Map position of balancer
Sequence of primersExtRev:TTCGGTGCGAAACGCGTCAG,IntRev:GCGTCAGCACTGCCCATGTT,ExtFwd:GGGTGCGATTACATTGATAC,IntFwd:TTCGCTACTGGCACCTCACT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Janiesch PC, Kim J, Mouysset J, Barikbin R, Lochm├╝ller H, Cassata G, Krause S, Hoppe T.
The ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human myopathy.
Nat. Cell Biol. 2007 9(4) 379-90 
[ PubMed ID = 17369820 ] [ RRC reference ]

Tjahjono E, Kirienko NV.
A conserved mitochondrial surveillance pathway is required for defense against Pseudomonas aeruginosa.
PLoS Genet. 2017 13(6) e1006876 
[ PubMed ID = 28662060 ] [ RRC reference ]