Mutants (Isolated)

tm1359

Allele Nametm1359
Allele TypeNormal
Sequence NameY44E3B.1
Gene Namezip-4
Worm BaseAllele Name tm1359
Gene Name zip-4
Sequence Y44E3B.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. Y. Jin: no movement phenotype, grows well.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 3582/3583-3979/3980 (397 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(3375..3447, 3500..4257, 4699..4824))
Map position-4.16
Balancer
Map position of balancer
Sequence of primersExtRev:TTCGGTGCGAAACGCGTCAG,IntRev:GCGTCAGCACTGCCCATGTT,ExtFwd:GGGTGCGATTACATTGATAC,IntFwd:TTCGCTACTGGCACCTCACT
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Zheng C, Jin FQ, Trippe BL, Wu J, Chalfie M.
Inhibition of cell fate repressors secures the differentiation of the touch receptor neurons of Caenorhabditis elegans.
Development 2018 145(22)  
[ PubMed ID = 30291162 ] [ RRC reference ]

Tjahjono E, Kirienko NV.
A conserved mitochondrial surveillance pathway is required for defense against Pseudomonas aeruginosa.
PLoS Genet 2017 13(6) e1006876 
[ PubMed ID = 28662060 ] [ RRC reference ]

Janiesch PC, Kim J, Mouysset J, Barikbin R, Lochmüller H, Cassata G, Krause S, Hoppe T.
The ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human myopathy.
Nat Cell Biol 2007 9(4) 379-90 
[ PubMed ID = 17369820 ] [ RRC reference ]