Allele Name | tm1359 |
Allele Type | 通常株 |
Sequence Name | Y44E3B.1 |
Gene Name | zip-4 |
Worm Base | Allele Name |
tm1359
|
Gene Name |
zip-4
|
Sequence |
Y44E3B.1
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. Y. Jin: no movement phenotype, grows well. |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 3582/3583-3979/3980 (397 bp deletion) |
Chromosome | I |
Putative gene structure | complement(join(3375..3447, 3500..4257, 4699..4824)) |
Map position | -4.16 |
Balancer | |
Map position of balancer | |
Sequence of primers | ExtRev:TTCGGTGCGAAACGCGTCAG,IntRev:GCGTCAGCACTGCCCATGTT,ExtFwd:GGGTGCGATTACATTGATAC,IntFwd:TTCGCTACTGGCACCTCACT |
Distributed lab | |
Depositor | Dr. S. Mitani |
References |
Please submit your publication
Zheng C, Jin FQ, Trippe BL, Wu J, Chalfie M. Inhibition of cell fate repressors secures the differentiation of the touch receptor neurons of Caenorhabditis elegans. Development 2018 145(22)
[ PubMed ID = 30291162 ]
[ RRC reference ]
|
Tjahjono E, Kirienko NV. A conserved mitochondrial surveillance pathway is required for defense against Pseudomonas aeruginosa. PLoS Genet 2017 13(6) e1006876
[ PubMed ID = 28662060 ]
[ RRC reference ]
|
Janiesch PC, Kim J, Mouysset J, Barikbin R, Lochmüller H, Cassata G, Krause S, Hoppe T. The ubiquitin-selective chaperone CDC-48/p97 links myosin assembly to human myopathy. Nat Cell Biol 2007 9(4) 379-90
[ PubMed ID = 17369820 ]
[ RRC reference ]
|
|