Mutants (Isolated)

tm1358

Allele Nametm1358
Sequence NameT01C3.8
CGC Namemut-15
Worm BaseAllele Name tm1358
CGC Name mut-15
Sequence T01C3.8
Phenotypehomozygous viable
Mutation site17346/17347-17738/17739 (392 bp deletion)
ChromosomeV
Putative gene structurejoin(16100..16136, 16186..16253, 16296..16341, 16389..16461, 16509..16677, 16720..17195, 17244..17367, 17413..17518, 17563..17692, 17746..18016, 18071..18196)
Map position7.14
Balancer
Map position of balancer
Sequence of primersIntRev:GGTAAAGATCGCGGAACCAC,ExtRev:GATTGTCGATCCGCCAGGTA,IntFwd:GATATCGCGCACGGGTTTAA,ExtFwd:CGATTGCTGGAGCGAGTCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Suen KM, Braukmann F, Butler R, Bensaddek D, Akay A, Lin CC, MilonaitytÄ— D, Doshi N, Sapetschnig A, Lamond A, Ladbury JE, Miska EA.
DEPS-1 is required for piRNA-dependent silencing and PIWI condensate organisation in Caenorhabditis elegans.
Nat Commun 2020 11(1) 4242 
[ PubMed ID = 32843637 ] [ RRC reference ]

Phillips CM, Montgomery TA, Breen PC, Ruvkun G.
MUT-16 promotes formation of perinuclear mutator foci required for RNA silencing in the C. elegans germline.
Genes Dev 2012 26(13) 1433-44 
[ PubMed ID = 22713602 ] [ RRC reference ]

Zhang C, Montgomery TA, Gabel HW, Fischer SE, Phillips CM, Fahlgren N, Sullivan CM, Carrington JC, Ruvkun G.
mut-16 and other mutator class genes modulate 22G and 26G siRNA pathways in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2011 108(4) 1201-8 
[ PubMed ID = 21245313 ] [ RRC reference ]

Phillips CM, Montgomery BE, Breen PC, Roovers EF, Rim YS, Ohsumi TK, Newman MA, van Wolfswinkel JC, Ketting RF, Ruvkun G, Montgomery TA.
MUT-14 and SMUT-1 DEAD box RNA helicases have overlapping roles in germline RNAi and endogenous siRNA formation.
Curr Biol 2014 24(8) 839-44 
[ PubMed ID = 24684932 ] [ RRC reference ]

Spracklin G, Fields B, Wan G, Becker D, Wallig A, Shukla A, Kennedy S.
The RNAi Inheritance Machinery of Caenorhabditis elegans.
Genetics 2017 206(3) 1403-1416 
[ PubMed ID = 28533440 ] [ RRC reference ]

Uebel CJ, Anderson DC, Mandarino LM, Manage KI, Aynaszyan S, Phillips CM.
Distinct regions of the intrinsically disordered protein MUT-16 mediate assembly of a small RNA amplification complex and promote phase separation of Mutator foci.
PLoS Genet 2018 14(7) e1007542 
[ PubMed ID = 30036386 ] [ RRC reference ]

Phillips CM, Brown KC, Montgomery BE, Ruvkun G, Montgomery TA.
piRNAs and piRNA-Dependent siRNAs Protect Conserved and Essential C. elegans Genes from Misrouting into the RNAi Pathway.
Dev Cell 2015 34(4) 457-65 
[ PubMed ID = 26279487 ] [ RRC reference ]

Tsai HY, Chen CC, Conte D Jr, Moresco JJ, Chaves DA, Mitani S, Yates JR 3rd, Tsai MD, Mello CC.
A ribonuclease coordinates siRNA amplification and mRNA cleavage during RNAi.
Cell 2015 160(3) 407-19 
[ PubMed ID = 25635455 ] [ RRC reference ]