| Allele Name | tm1354 |
| Balance | Not Required |
| OutCross | Not Accepted |
| Sequence Name | F39H2.5 |
| Gene Name | mrt-1 |
| Worm Base | Allele Name |
tm1354
|
| Gene Name |
mrt-1
|
| Sequence |
F39H2.5
|
Phenotype
Information from the receiver is posted in the form
of a "researcher : phenotype"
| homozygous viable. |
|
Mutation site
Please see gene structure to locate the deletion in
relation to exon(s)
| 13659/13660-14207/14208 (548 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(12854..13032, 13080..13248, 13299..13636, 13686..13817, 13867..14202, 14258..14476, 14523..14777, 14878..15076) |
| Map position | 3.02 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CCTAAACCAGCCATGTCCAC,ExtRev:GATGCCAGCTCAATGATAGA,IntRev:CACGCCCAAGTCTATGCAAG,IntFwd:TACTGCTGTATTGGACCGCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Dietz S, Almeida MV, Nischwitz E, Schreier J, Viceconte N, Fradera-Sola A, Renz C, Ceron-Noriega A, Ulrich HD, Kappei D, Ketting RF, Butter F.
The double-stranded DNA-binding proteins TEBP-1 and TEBP-2 form a telomeric complex with POT-1.
Nat Commun 2021 12(1) 2668
[ PubMed ID = 33976151 ]
[ RRC reference ]
|
Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480
[ PubMed ID = 28934497 ]
[ RRC reference ]
|
Meier B, Barber LJ, Liu Y, Shtessel L, Boulton SJ, Gartner A, Ahmed S.
The MRT-1 nuclease is required for DNA crosslink repair and telomerase activity in vivo in Caenorhabditis elegans.
EMBO J 2009 28(22) 3549-63
[ PubMed ID = 19779462 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.