Mutants (Isolated)

tm1354

Allele Nametm1354
BalanceNot Required
OutCrossNot Accepted
Sequence NameF39H2.5
Gene Namemrt-1
Worm BaseAllele Name tm1354
Gene Name mrt-1
Sequence F39H2.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 13659/13660-14207/14208 (548 bp deletion)
ChromosomeI
Putative gene structurejoin(12854..13032, 13080..13248, 13299..13636, 13686..13817, 13867..14202, 14258..14476, 14523..14777, 14878..15076)
Map position3.02
Balancer
Map position of balancer
Sequence of primersExtFwd:CCTAAACCAGCCATGTCCAC,ExtRev:GATGCCAGCTCAATGATAGA,IntRev:CACGCCCAAGTCTATGCAAG,IntFwd:TACTGCTGTATTGGACCGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dietz S, Almeida MV, Nischwitz E, Schreier J, Viceconte N, Fradera-Sola A, Renz C, Ceron-Noriega A, Ulrich HD, Kappei D, Ketting RF, Butter F.
The double-stranded DNA-binding proteins TEBP-1 and TEBP-2 form a telomeric complex with POT-1.
Nat Commun 2021 12(1) 2668 
[ PubMed ID = 33976151 ] [ RRC reference ]

Wilson DM 3rd, Rieckher M, Williams AB, Schumacher B.
Systematic analysis of DNA crosslink repair pathways during development and aging in Caenorhabditis elegans.
Nucleic Acids Res 2017 45(16) 9467-9480 
[ PubMed ID = 28934497 ] [ RRC reference ]

Meier B, Barber LJ, Liu Y, Shtessel L, Boulton SJ, Gartner A, Ahmed S.
The MRT-1 nuclease is required for DNA crosslink repair and telomerase activity in vivo in Caenorhabditis elegans.
EMBO J 2009 28(22) 3549-63 
[ PubMed ID = 19779462 ] [ RRC reference ]