Mutants (Isolated)

tm1340

Allele Nametm1340
Sequence NameT01E8.3
CGC Nameplc-3
Worm BaseAllele Name tm1340
CGC Name plc-3
Sequence T01E8.3
Phenotypelethal or sterile. Dr. P. Bazzicalupo: unable to test for any chemotaxis behavior due to lethality. Dr. P. Sternberg: Nature Neurosci. 10, 1300-1307 (2007). Dr. E. Jorgensen: defacation cycle normal.
Mutation site16163/16164-A-16523/16524 (360 bp deletion + 1 bp insertion)
ChromosomeII
Putative gene structurejoin(15050..15345, 15394..15576, 15828..16301, 16354..16439, 16491..16859, 16935..17363, 17461..18159, 19437..19577, 19868..20506, 20570..20862, 20905..21095, 21140..21239)
Map position2.31
BalancermIn1 [mIs14]
Map position of balancer
Sequence of primersExtFwd:CTCAGCATGCAACACGGCTC,IntFwd:AG84TAACCAGCACAGCGGGCT,ExtRev:CAGCGGTTTGAATCAGGTAG,IntRev:ATGTCCATTCGTGACTGTTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Yeon J, Kim J, Kim DY, Kim H, Kim J, Du EJ, Kang K, Lim HH, Moon D, Kim K.
A sensory-motor neuron type mediates proprioceptive coordination of steering in C. elegans via two TRPC channels.
PLoS Biol 2018 16(6) e2004929 
[ PubMed ID = 29883446 ] [ RRC reference ]

Goetting DL, Soto R, Van Buskirk C.
Food-Dependent Plasticity in Caenorhabditis elegans Stress-Induced Sleep Is Mediated by TOR-FOXA and TGF-β Signaling.
Genetics 2018 209(4) 1183-1195 
[ PubMed ID = 29925566 ] [ RRC reference ]

Fry AL, Laboy JT, Huang H, Hart AC, Norman KR.
A Conserved GEF for Rho-Family GTPases Acts in an EGF Signaling Pathway to Promote Sleep-like Quiescence in Caenorhabditis elegans.
Genetics 2016 202(3) 1153-66 
[ PubMed ID = 26801183 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]

Schumacher JA, Hsieh YW, Chen S, Pirri JK, Alkema MJ, Li WH, Chang C, Chuang CF.
Intercellular calcium signaling in a gap junction-coupled cell network establishes asymmetric neuronal fates in C. elegans.
Development 2012 139(22) 4191-201 
[ PubMed ID = 23093425 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc Natl Acad Sci U S A 2013 110(29) 11940-5 
[ PubMed ID = 23818641 ] [ RRC reference ]

Alan JK, Struckhoff EC, Lundquist EA.
Multiple cytoskeletal pathways and PI3K signaling mediate CDC-42-induced neuronal protrusion in C. elegans.
Small GTPases 2013 4(4) 208-20 
[ PubMed ID = 24149939 ] [ RRC reference ]

Jiang HS, Wu YC.
LIN-3/EGF promotes the programmed cell death of specific cells in Caenorhabditis elegans by transcriptional activation of the pro-apoptotic gene egl-1.
PLoS Genet 2014 10(8) e1004513 
[ PubMed ID = 25144461 ] [ RRC reference ]

Hill AJ, Mansfield R, Lopez JM, Raizen DM, Van Buskirk C.
Cellular stress induces a protective sleep-like state in C. elegans.
Curr Biol 2014 24(20) 2399-405 
[ PubMed ID = 25264259 ] [ RRC reference ]

Aprison EZ, Ruvinsky I.
Balanced trade-offs between alternative strategies shape the response of C. elegans reproduction to chronic heat stress.
PLoS One 2014 9(8) e105513 
[ PubMed ID = 25165831 ] [ RRC reference ]

Walker DS, Vázquez-Manrique RP, Gower NJ, Gregory E, Schafer WR, Baylis HA.
Inositol 1,4,5-trisphosphate signalling regulates the avoidance response to nose touch in Caenorhabditis elegans.
PLoS Genet 2009 5(9) e1000636 
[ PubMed ID = 19730689 ] [ RRC reference ]

Vázquez-Manrique RP, Nagy AI, Legg JC, Bales OA, Ly S, Baylis HA.
Phospholipase C-epsilon regulates epidermal morphogenesis in Caenorhabditis elegans.
PLoS Genet 2008 4(3) e1000043 
[ PubMed ID = 18369461 ] [ RRC reference ]

Van Buskirk C, Sternberg PW.
Epidermal growth factor signaling induces behavioral quiescence in Caenorhabditis elegans.
Nat Neurosci 2007 10(10) 1300-7 
[ PubMed ID = 17891142 ] [ RRC reference ]

Espelt MV, Estevez AY, Yin X, Strange K.
Oscillatory Ca2+ signaling in the isolated Caenorhabditis elegans intestine: role of the inositol-1,4,5-trisphosphate receptor and phospholipases C beta and gamma.
J Gen Physiol 2005 126(4) 379-92 
[ PubMed ID = 16186564 ] [ RRC reference ]