分離済み変異体

tm1340

Allele Name

tm1340

Balance

Completed

OutCross

Not Accepted

Sequence Name

T01E8.3

Gene Name

plc-3

Worm Base

Allele Name

tm1340 (x1)

Gene Name

plc-3

Sequence

T01E8.3

Phenotype

lethal or sterile. Dr. P. Bazzicalupo: unable to test for any chemotaxis behavior due to lethality. Dr. P. Sternberg: Nature Neurosci. 10, 1300-1307 (2007). Dr. E. Jorgensen: defacation cycle normal.

Mutation site

16163/16164-A-16523/16524 (360 bp deletion + 1 bp insertion)

Chromosome

Putative gene structure

join(15050..15345, 15394..15576, 15828..16301, 16354..16439, 16491..16859, 16935..17363, 17461..18159, 19437..19577, 19868..20506, 20570..20862, 20905..21095, 21140..21239)

Map position

2.31

Balancer

mIn1 [e128 mIs14]

Map position of balancer

Sequence of primers

ExtFwd:CTCAGCATGCAACACGGCTC,IntFwd:AG84TAACCAGCACAGCGGGCT,ExtRev:CAGCGGTTTGAATCAGGTAG,IntRev:ATGTCCATTCGTGACTGTTG

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Kawano T, Kashiwagi M, Kanuka M, Chen CK, Yasugaki S, Hatori S, Miyazaki S, Tanaka K, Fujita H, Nakajima T, Yanagisawa M, Nakagawa Y, Hayashi Y.
ER proteostasis regulators cell-non-autonomously control sleep.
Cell Rep 2023 42(3) 112267
[ PubMed ID = 36924492 ] [ RRC reference ]

Goetting DL, Soto R, Van Buskirk C.
Food-Dependent Plasticity in Caenorhabditis elegans Stress-Induced Sleep Is Mediated by TOR-FOXA and TGF-β Signaling.
Genetics 2018 209(4) 1183-1195
[ PubMed ID = 29925566 ] [ RRC reference ]

Yeon J, Kim J, Kim DY, Kim H, Kim J, Du EJ, Kang K, Lim HH, Moon D, Kim K.
A sensory-motor neuron type mediates proprioceptive coordination of steering in C. elegans via two TRPC channels.
PLoS Biol 2018 16(6) e2004929
[ PubMed ID = 29883446 ] [ RRC reference ]

Fry AL, Laboy JT, Huang H, Hart AC, Norman KR.
A Conserved GEF for Rho-Family GTPases Acts in an EGF Signaling Pathway to Promote Sleep-like Quiescence in Caenorhabditis elegans.
Genetics 2016 202(3) 1153-66
[ PubMed ID = 26801183 ] [ RRC reference ]

Hill AJ, Mansfield R, Lopez JM, Raizen DM, Van Buskirk C.
Cellular stress induces a protective sleep-like state in C. elegans.
Curr Biol 2014 24(20) 2399-405
[ PubMed ID = 25264259 ] [ RRC reference ]

Jiang HS, Wu YC.
LIN-3/EGF promotes the programmed cell death of specific cells in Caenorhabditis elegans by transcriptional activation of the pro-apoptotic gene egl-1.
PLoS Genet 2014 10(8) e1004513
[ PubMed ID = 25144461 ] [ RRC reference ]

Aprison EZ, Ruvinsky I.
Balanced trade-offs between alternative strategies shape the response of C. elegans reproduction to chronic heat stress.
PLoS One 2014 9(8) e105513
[ PubMed ID = 25165831 ] [ RRC reference ]

Yu H, Aleman-Meza B, Gharib S, Labocha MK, Cronin CJ, Sternberg PW, Zhong W.
Systematic profiling of Caenorhabditis elegans locomotive behaviors reveals additional components in G-protein Gαq signaling.
Proc Natl Acad Sci U S A 2013 110(29) 11940-5
[ PubMed ID = 23818641 ] [ RRC reference ]

Alan JK, Struckhoff EC, Lundquist EA.
Multiple cytoskeletal pathways and PI3K signaling mediate CDC-42-induced neuronal protrusion in C. elegans.
Small GTPases 2013 4(4) 208-20
[ PubMed ID = 24149939 ] [ RRC reference ]

Schumacher JA, Hsieh YW, Chen S, Pirri JK, Alkema MJ, Li WH, Chang C, Chuang CF.
Intercellular calcium signaling in a gap junction-coupled cell network establishes asymmetric neuronal fates in C. elegans.
Development 2012 139(22) 4191-201
[ PubMed ID = 23093425 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ] [ RRC reference ]

Walker DS, Vázquez-Manrique RP, Gower NJ, Gregory E, Schafer WR, Baylis HA.
Inositol 1,4,5-trisphosphate signalling regulates the avoidance response to nose touch in Caenorhabditis elegans.
PLoS Genet 2009 5(9) e1000636
[ PubMed ID = 19730689 ] [ RRC reference ]

Vázquez-Manrique RP, Nagy AI, Legg JC, Bales OA, Ly S, Baylis HA.
Phospholipase C-epsilon regulates epidermal morphogenesis in Caenorhabditis elegans.
PLoS Genet 2008 4(3) e1000043
[ PubMed ID = 18369461 ] [ RRC reference ]

Van Buskirk C, Sternberg PW.
Epidermal growth factor signaling induces behavioral quiescence in Caenorhabditis elegans.
Nat Neurosci 2007 10(10) 1300-7
[ PubMed ID = 17891142 ] [ RRC reference ]

Espelt MV, Estevez AY, Yin X, Strange K.
Oscillatory Ca2+ signaling in the isolated Caenorhabditis elegans intestine: role of the inositol-1,4,5-trisphosphate receptor and phospholipases C beta and gamma.
J Gen Physiol 2005 126(4) 379-92
[ PubMed ID = 16186564 ] [ RRC reference ]