| Allele Name | tm1326 |
| Sequence Name | ZC410.2 |
| CGC Name | ZC410.2 |
| Worm Base | Allele Name |
tm1326
|
| CGC Name |
ZC410.2
|
| Sequence |
ZC410.2
|
| Phenotype | lethal or sterile |
| Mutation site | 8292/8293-8908/8909 (616 bp deletion) |
| Chromosome | IV |
| Putative gene structure | join(8526..8558, 8605..8727, 8777..8863, 8924..9053, 9107..9492, 9576..9680, 9736..9855, 9907..10003, 10052..10347) |
| Map position | 4.03 |
| Balancer | nT1 [qIs51] |
| Map position of balancer | |
| Sequence of primers | ExtFwd:TAAGGATCGCTAGATACCCA,IntFwd:GCTAGATACCCACTCCTGTT,ExtRev:GCTTGGCACGATCAACCGCT,IntRev:TGTTCGCAAGCCAAACCCAT |
| Distributed lab | |
| Depositor | Dr. S. Mitani/NBRP |
| References |
Please submit your publication
Nomura H, Athauda SB, Wada H, Maruyama Y, Takahashi K, Inoue H.
Identification and reverse genetic analysis of mitochondrial processing peptidase and the core protein of the cytochrome bc1 complex of Caenorhabditis elegans, a model parasitic nematode.
J. Biochem. 2006 139(6) 967-79
[ PubMed ID = 16788047 ]
[ RRC reference ]
|
C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25
[ PubMed ID = 23173093 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.