Mutants (Isolated)

tm1326

Allele Nametm1326
Sequence NameZC410.2
CGC NameZC410.2
Worm BaseAllele Name tm1326
CGC Name ZC410.2
Sequence ZC410.2
Phenotypelethal or sterile
Mutation site8292/8293-8908/8909 (616 bp deletion)
ChromosomeIV
Putative gene structurejoin(8526..8558, 8605..8727, 8777..8863, 8924..9053, 9107..9492, 9576..9680, 9736..9855, 9907..10003, 10052..10347)
Map position4.03
BalancernT1 [qIs51]
Map position of balancer
Sequence of primersExtFwd:TAAGGATCGCTAGATACCCA,IntFwd:GCTAGATACCCACTCCTGTT,ExtRev:GCTTGGCACGATCAACCGCT,IntRev:TGTTCGCAAGCCAAACCCAT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Nomura H, Athauda SB, Wada H, Maruyama Y, Takahashi K, Inoue H.
Identification and reverse genetic analysis of mitochondrial processing peptidase and the core protein of the cytochrome bc1 complex of Caenorhabditis elegans, a model parasitic nematode.
J. Biochem. 2006 139(6) 967-79 
[ PubMed ID = 16788047 ] [ RRC reference ]

C. elegans Deletion Mutant Consortium.
large-scale screening for targeted knockouts in the Caenorhabditis elegans genome.
G3 (Bethesda) 2012 2(11) 1415-25 
[ PubMed ID = 23173093 ] [ RRC reference ]