分離済み変異体

tm1312

Allele Nametm1312
Allele Type通常株
Sequence NameZC518.3
Gene Nameccr-4
Worm BaseAllele Name tm1312
Gene Name ccr-4
Sequence ZC518.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. H. Sawa: non Psa. Dr. A. Puoti: occasional sterilities (3%).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 21011/21012-21506/21507 (495 bp deletion)
ChromosomeIV
Putative gene structurejoin(14243..14262, 15220..15419, 15468..15571, 16058..16316, 20576..20644, 20965..21429, 21479..22006, 22632..22807)
Map position5.86
Balancer
Map position of balancer
Sequence of primersIntFwd:GGGGACGACGACATCTCTGA,ExtRev:GCTACATGTGGATGAGGGAA,ExtFwd:GTCGCTTTCTGTGAGCGGTC,IntRev:CCACTGTGGGTCAAATGGTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Kow RL, Strovas TJ, McMillan PJ, Jacobi AM, Behlke MA, Saxton AD, Latimer CS, Keene CD, Kraemer BC.
Distinct Poly(A) nucleases have differential impact on sut-2 dependent tauopathy phenotypes.
Neurobiol Dis 2021 147 105148 
[ PubMed ID = 33184027 ] [ RRC reference ]

Nousch M, Yeroslaviz A, Eckmann CR.
Stage-specific combinations of opposing poly(A) modifying enzymes guide gene expression during early oogenesis.
Nucleic Acids Res 2019 47(20) 10881-10893 
[ PubMed ID = 31511882 ] [ RRC reference ]

Zanetti S, Grinschgl S, Meola M, Belfiore M, Rey S, Bianchi P, Puoti A.
The sperm-oocyte switch in the C. elegans hermaphrodite is controlled through steady-state levels of the fem-3 mRNA.
RNA 2012 18(7) 1385-94 
[ PubMed ID = 22635404 ] [ RRC reference ]

Minasaki R, Rudel D, Eckmann CR.
Increased sensitivity and accuracy of a single-stranded DNA splint-mediated ligation assay (sPAT) reveals poly(A) tail length dynamics of developmentally regulated mRNAs.
RNA Biol 2014 11(2) 111-23 
[ PubMed ID = 24526206 ] [ RRC reference ]

Nousch M, Techritz N, Hampel D, Millonigg S, Eckmann CR.
The Ccr4-Not deadenylase complex constitutes the main poly(A) removal activity in C. elegans.
J Cell Sci 2013 126(Pt 18) 4274-85 
[ PubMed ID = 23843623 ] [ RRC reference ]

Rocheleau CE, Cullison K, Huang K, Bernstein Y, Spilker AC, Sundaram MV.
The Caenorhabditis elegans ekl (enhancer of ksr-1 lethality) genes include putative components of a germline small RNA pathway.
Genetics 2008 178(3) 1431-43 
[ PubMed ID = 18245826 ] [ RRC reference ]