Mutants (Isolated)

tm1312

Allele Nametm1312
Sequence NameZC518.3
CGC Nameccr-4
Worm BaseAllele Name tm1312
CGC Name ccr-4
Sequence ZC518.3
Phenotypehomozygous viable. Dr. H. Sawa: non Psa. Dr. A. Puoti: occasional sterilities (3%).
Mutation site21011/21012-21506/21507 (495 bp deletion)
ChromosomeIV
Putative gene structurejoin(14243..14262, 15220..15419, 15468..15571, 16058..16316, 20576..20644, 20965..21429, 21479..22006, 22632..22807)
Map position5.86
Balancer
Map position of balancer
Sequence of primersIntFwd:GGGGACGACGACATCTCTGA,ExtRev:GCTACATGTGGATGAGGGAA,ExtFwd:GTCGCTTTCTGTGAGCGGTC,IntRev:CCACTGTGGGTCAAATGGTC
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Minasaki R, Rudel D, Eckmann CR.
Increased sensitivity and accuracy of a single-stranded DNA splint-mediated ligation assay (sPAT) reveals poly(A) tail length dynamics of developmentally regulated mRNAs.
RNA Biol 2014 11(2) 111-23 
[ PubMed ID = 24526206 ] [ RRC reference ]

Zanetti S, Grinschgl S, Meola M, Belfiore M, Rey S, Bianchi P, Puoti A.
The sperm-oocyte switch in the C. elegans hermaphrodite is controlled through steady-state levels of the fem-3 mRNA.
RNA 2012 18(7) 1385-94 
[ PubMed ID = 22635404 ] [ RRC reference ]

Nousch M, Yeroslaviz A, Eckmann CR.
Stage-specific combinations of opposing poly(A) modifying enzymes guide gene expression during early oogenesis.
Nucleic Acids Res. 2019 47(20) 10881-10893 
[ PubMed ID = 31511882 ] [ RRC reference ]

Nousch M, Techritz N, Hampel D, Millonigg S, Eckmann CR.
The Ccr4-Not deadenylase complex constitutes the main poly(A) removal activity in C. elegans.
J. Cell. Sci. 2013 126(Pt 18) 4274-85 
[ PubMed ID = 23843623 ] [ RRC reference ]

Rocheleau CE, Cullison K, Huang K, Bernstein Y, Spilker AC, Sundaram MV.
The Caenorhabditis elegans ekl (enhancer of ksr-1 lethality) genes include putative components of a germline small RNA pathway.
Genetics 2008 178(3) 1431-43 
[ PubMed ID = 18245826 ] [ RRC reference ]