分離済み変異体

tm1304

Allele Nametm1304
BalanceNot Required
OutCrossNot Accepted
Sequence NameB0395.4
Gene Namemir-84
Worm BaseAllele Name tm1304
Gene Name mir-84
Sequence B0395.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. G. Ruvkun: strongly enhances the penetrance of entry into a supernumerary molt of let-7(mg279). It also weakly enhances the retarded seam cell division phenotypes of let-7(n2853) and daf-12(RNAi). Development 133, 4631-4641 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 2774/2775-3428/3429 (654 bp deletion)
ChromosomeX
Putative gene structurecomplement(3330..3351)
Map position23.68
Balancer
Map position of balancer
Sequence of primersExtFwd:TGGCTGTATCGCAGCCCTGT,IntFwd:GTATAGGAGGAACGGGCTTG,ExtRev:CCTCTCTCCTAGTCGCTGGT,IntRev:CTCTTACAGCCATCACCCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Patel R, Galagali H, Kim JK, Frand AR.
Feedback between a retinoid-related nuclear receptor and the let-7 microRNAs controls the pace and number of molting cycles in C. elegans.
Elife 2022 11  
[ PubMed ID = 35968765 ] [ RRC reference ]

Chu YD, Chen HK, Huang T, Chan SP.
A novel function for the DEAD-box RNA helicase DDX-23 in primary microRNA processing in Caenorhabditis elegans.
Dev Biol 2016 409(2) 459-72 
[ PubMed ID = 26601717 ] [ RRC reference ]

Akay A, Craig A, Lehrbach N, Larance M, Pourkarimi E, Wright JE, Lamond A, Miska E, Gartner A.
RNA-binding protein GLD-1/quaking genetically interacts with the mir-35 and the let-7 miRNA pathways in Caenorhabditis elegans.
Open Biol 2013 3(11) 130151 
[ PubMed ID = 24258276 ] [ RRC reference ]

Thompson-Peer KL, Bai J, Hu Z, Kaplan JM.
HBL-1 patterns synaptic remodeling in C. elegans.
Neuron 2012 73(3) 453-65 
[ PubMed ID = 22325199 ] [ RRC reference ]

Hayes GD, Riedel CG, Ruvkun G.
The Caenorhabditis elegans SOMI-1 zinc finger protein and SWI/SNF promote regulation of development by the mir-84 microRNA.
Genes Dev 2011 25(19) 2079-92 
[ PubMed ID = 21979920 ] [ RRC reference ]

Vázquez-Manrique RP, Nagy AI, Legg JC, Bales OA, Ly S, Baylis HA.
Phospholipase C-epsilon regulates epidermal morphogenesis in Caenorhabditis elegans.
PLoS Genet 2008 4(3) e1000043 
[ PubMed ID = 18369461 ] [ RRC reference ]

Weidhaas JB, Babar I, Nallur SM, Trang P, Roush S, Boehm M, Gillespie E, Slack FJ.
MicroRNAs as potential agents to alter resistance to cytotoxic anticancer therapy.
Cancer Res 2007 67(23) 11111-6 
[ PubMed ID = 18056433 ] [ RRC reference ]

Hayes GD, Frand AR, Ruvkun G.
The mir-84 and let-7 paralogous microRNA genes of Caenorhabditis elegans direct the cessation of molting via the conserved nuclear hormone receptors NHR-23 and NHR-25.
Development 2006 133(23) 4631-41 
[ PubMed ID = 17065234 ] [ RRC reference ]