分離済み変異体

tm1301

Allele Nametm1301
BalanceNot Required
OutCrossNot Accepted
Sequence NameY38A10A.6
Gene Namesmut-1
Worm BaseAllele Name tm1301
Gene Name smut-1
Sequence Y38A10A.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 42934/42935-A-43495/43496 (561 bp deletion + 1 bp insertion)
ChromosomeV
Putative gene structurejoin(41953..42085, 42133..42660, 42708..43213, 43262..43429, 43512..43739)
Map position-0.35
Balancer
Map position of balancer
Sequence of primersIntFwd:CTGTATAATGGACCGTCGCT,ExtFwd:CGGTGGCATGATGCTCGACA,IntRev:GGACAGTAGCTCTTCCACCA,ExtRev:CGTTTCCTCGCATTCGAGCA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Montgomery BE, Vijayasarathy T, Marks TN, Cialek CA, Reed KJ, Montgomery TA.
Dual roles for piRNAs in promoting and preventing gene silencing in C. elegans.
Cell Rep 2021 37(10) 110101 
[ PubMed ID = 34879267 ] [ RRC reference ]

Yen CA, Ruter DL, Turner CD, Pang S, Curran SP.
Loss of flavin adenine dinucleotide (FAD) impairs sperm function and male reproductive advantage in C. elegans.
Elife 2020 9  
[ PubMed ID = 32022684 ] [ RRC reference ]

Svendsen JM, Reed KJ, Vijayasarathy T, Montgomery BE, Tucci RM, Brown KC, Marks TN, Nguyen DAH, Phillips CM, Montgomery TA.
henn-1/HEN1 Promotes Germline Immortality in Caenorhabditis elegans.
Cell Rep 2019 29(10) 3187-3199.e4 
[ PubMed ID = 31801082 ] [ RRC reference ]

Uebel CJ, Anderson DC, Mandarino LM, Manage KI, Aynaszyan S, Phillips CM.
Distinct regions of the intrinsically disordered protein MUT-16 mediate assembly of a small RNA amplification complex and promote phase separation of Mutator foci.
PLoS Genet 2018 14(7) e1007542 
[ PubMed ID = 30036386 ] [ RRC reference ]

Phillips CM, Brown KC, Montgomery BE, Ruvkun G, Montgomery TA.
piRNAs and piRNA-Dependent siRNAs Protect Conserved and Essential C. elegans Genes from Misrouting into the RNAi Pathway.
Dev Cell 2015 34(4) 457-65 
[ PubMed ID = 26279487 ] [ RRC reference ]

Phillips CM, Montgomery BE, Breen PC, Roovers EF, Rim YS, Ohsumi TK, Newman MA, van Wolfswinkel JC, Ketting RF, Ruvkun G, Montgomery TA.
MUT-14 and SMUT-1 DEAD box RNA helicases have overlapping roles in germline RNAi and endogenous siRNA formation.
Curr Biol 2014 24(8) 839-44 
[ PubMed ID = 24684932 ] [ RRC reference ]