Mutants (Isolated)

tm1301

Allele Nametm1301
Sequence NameY38A10A.6
CGC Namesmut-1
Worm BaseAllele Name tm1301
CGC Name smut-1
Sequence Y38A10A.6
Phenotypehomozygous viable
Mutation site42934/42935-A-43495/43496 (561 bp deletion + 1 bp insertion)
ChromosomeV
Putative gene structurejoin(41953..42085, 42133..42660, 42708..43213, 43262..43429, 43512..43739)
Map position-0.35
Balancer
Map position of balancer
Sequence of primersExtRev:CGTTTCCTCGCATTCGAGCA,IntRev:GGACAGTAGCTCTTCCACCA,ExtFwd:CGGTGGCATGATGCTCGACA,IntFwd:CTGTATAATGGACCGTCGCT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Phillips CM, Montgomery BE, Breen PC, Roovers EF, Rim YS, Ohsumi TK, Newman MA, van Wolfswinkel JC, Ketting RF, Ruvkun G, Montgomery TA.
MUT-14 and SMUT-1 DEAD box RNA helicases have overlapping roles in germline RNAi and endogenous siRNA formation.
Curr. Biol. 2014 24(8) 839-44 
[ PubMed ID = 24684932 ] [ RRC reference ]

Phillips CM, Brown KC, Montgomery BE, Ruvkun G, Montgomery TA.
piRNAs and piRNA-Dependent siRNAs Protect Conserved and Essential C. elegans Genes from Misrouting into the RNAi Pathway.
Dev. Cell 2015 34(4) 457-65 
[ PubMed ID = 26279487 ] [ RRC reference ]

Uebel CJ, Anderson DC, Mandarino LM, Manage KI, Aynaszyan S, Phillips CM.
Distinct regions of the intrinsically disordered protein MUT-16 mediate assembly of a small RNA amplification complex and promote phase separation of Mutator foci.
PLoS Genet. 2018 14(7) e1007542 
[ PubMed ID = 30036386 ] [ RRC reference ]