分離済み変異体

tm1283

Allele Nametm1283
BalanceCompleted
OutCrossNot Accepted
Sequence NameT01G9.6
Gene Namekin-10
Worm BaseAllele Name tm1283 (x1)
Gene Name kin-10
Sequence T01G9.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. M.M. Barr: Mol. Biol. Cell, 17, 2200-2211 (2006). Dr. G. Garriga: no AVM/PVM or PLMs either alone or in ced-3 (n717) background. tm1283 did not have any extra cells but RNAi to kin-10 generated moderate phenotype.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 17561/17562-AGAAAAACTCA-17976/17977 (415 bp deletion + 11 bp insertion)
ChromosomeI
Putative gene structurecomplement(join(16159..16309, 16842..17031, 17199..17387, 17441..17597, 17755..17772))
Map position2.71
Balancer,hT2
Map position of balancer
Sequence of primersExtFwd:TGTTGTTTTGTGCTGCGGCA,IntFwd:GCGGCAACGTTATTCGCCGT,ExtRev:CCTATGTGCTATGCAACCGT,IntRev:TGCCCCATTGCACGTCCACA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Chen X, Wang K, Mufti FUD, Xu D, Zhu C, Huang X, Zeng C, Jin Q, Huang X, Yan YH, Dong MQ, Feng X, Shi Y, Kennedy S, Guang S.
Germ granule compartments coordinate specialized small RNA production.
Nat Commun 2024 15(1) 5799 
[ PubMed ID = 38987544 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Wang X, Gupta P, Fairbanks J, Hansen D.
Protein kinase CK2 both promotes robust proliferation and inhibits the proliferative fate in the C. elegans germ line.
Dev Biol 2014 392(1) 26-41 
[ PubMed ID = 24824786 ] [ RRC reference ]

Hu J, Bae YK, Knobel KM, Barr MM.
Casein kinase II and calcineurin modulate TRPP function and ciliary localization.
Mol Biol Cell 2006 17(5) 2200-11 
[ PubMed ID = 16481400 ] [ RRC reference ]