Mutants (Isolated)

tm1268

Allele Nametm1268
BalanceCompleted
OutCrossNot Accepted
Sequence NameW06D4.6
Gene Namerad-54
Worm BaseAllele Name tm1268 (x1)
Gene Name rad-54
Sequence W06D4.6
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. S. Boulton: sterile, abnormal meiosis. Dr. M. Hengartner: maternal effect Emb, increased level of apoptosis. Dr. M. Jantsch: no meiotic phenotype.
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 16239/16240-17050/17051 (811 bp deletion)
ChromosomeI
Putative gene structurejoin(15017..15120, 15535..15613, 15687..15930, 15974..16113, 16213..16558, 16632..16756, 16802..16920, 16965..17042, 17090..17216, 17265..17372, 17418..17526, AL110471.1:303..469, AL110471.1:860..1201, AL110471.1:1629..1726, AL110471.1:1848..1959, AL110471.1:2003..2077, AL110471.1:2369..2452)
Map position3.49
BalancerhT2
Map position of balancer
Sequence of primersExtRev:CAGATGCGGTGGCACCCTAA,IntRev:GGCGTCGCGACCTCTAGAAA,ExtFwd:GAAGGCACTGCCTGCCATAG,IntFwd:GCCTGCCATAGAACCACCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lawrence KS, Tapley EC, Cruz VE, Li Q, Aung K, Hart KC, Schwartz TU, Starr DA, Engebrecht J.
LINC complexes promote homologous recombination in part through inhibition of nonhomologous end joining.
J Cell Biol 2016 215(6) 801-821 
[ PubMed ID = 27956467 ] [ RRC reference ]

Stamper EL, Rodenbusch SE, Rosu S, Ahringer J, Villeneuve AM, Dernburg AF.
Identification of DSB-1, a protein required for initiation of meiotic recombination in Caenorhabditis elegans, illuminates a crossover assurance checkpoint.
PLoS Genet 2013 9(8) e1003679 
[ PubMed ID = 23990794 ] [ RRC reference ]

Stergiou L, Eberhard R, Doukoumetzidis K, Hengartner MO.
NER and HR pathways act sequentially to promote UV-C-induced germ cell apoptosis in Caenorhabditis elegans.
Cell Death Differ 2011 18(5) 897-906 
[ PubMed ID = 21151025 ] [ RRC reference ]

Ward JD, Muzzini DM, Petalcorin MI, Martinez-Perez E, Martin JS, Plevani P, Cassata G, Marini F, Boulton SJ.
Overlapping mechanisms promote postsynaptic RAD-51 filament disassembly during meiotic double-strand break repair.
Mol Cell 2010 37(2) 259-72 
[ PubMed ID = 20122407 ] [ RRC reference ]