Mutants (Isolated)

tm1268

Allele Nametm1268
Sequence NameW06D4.6
CGC Namerad-54
Worm BaseAllele Name tm1268
CGC Name rad-54
Sequence W06D4.6
Phenotypelethal or sterile. Dr. S. Boulton: sterile, abnormal meiosis. Dr. M. Hengartner: maternal effect Emb, increased level of apoptosis. Dr. M. Jantsch: no meiotic phenotype.
Mutation site16239/16240-17050/17051 (811 bp deletion)
ChromosomeI
Putative gene structurejoin(15017..15120, 15535..15613, 15687..15930, 15974..16113, 16213..16558, 16632..16756, 16802..16920, 16965..17042, 17090..17216, 17265..17372, 17418..17526, AL110471.1:303..469, AL110471.1:860..1201, AL110471.1:1629..1726, AL110471.1:1848..1959, AL110471.1:2003..2077, AL110471.1:2369..2452)
Map position3.49
BalancerhT2
Map position of balancer
Sequence of primersExtRev:CAGATGCGGTGGCACCCTAA,IntRev:GGCGTCGCGACCTCTAGAAA,ExtFwd:GAAGGCACTGCCTGCCATAG,IntFwd:GCCTGCCATAGAACCACCTG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Stamper EL, Rodenbusch SE, Rosu S, Ahringer J, Villeneuve AM, Dernburg AF.
Identification of DSB-1, a protein required for initiation of meiotic recombination in Caenorhabditis elegans, illuminates a crossover assurance checkpoint.
PLoS Genet. 2013 9(8) e1003679 
[ PubMed ID = 23990794 ] [ RRC reference ]

Stergiou L, Eberhard R, Doukoumetzidis K, Hengartner MO.
NER and HR pathways act sequentially to promote UV-C-induced germ cell apoptosis in Caenorhabditis elegans.
Cell Death Differ. 2011 18(5) 897-906 
[ PubMed ID = 21151025 ] [ RRC reference ]

Ward JD, Muzzini DM, Petalcorin MI, Martinez-Perez E, Martin JS, Plevani P, Cassata G, Marini F, Boulton SJ.
Overlapping mechanisms promote postsynaptic RAD-51 filament disassembly during meiotic double-strand break repair.
Mol. Cell 2010 37(2) 259-72 
[ PubMed ID = 20122407 ] [ RRC reference ]