Home > Mutants (Isolated) > tm12463

Mutants (Isolated)

tm12463

Allele Nametm12463
BalanceNot Required
OutCrossCompleted
Sequence NameF02A9.10
Gene NameF02A9.10
Worm BaseAllele Name tm12463 (x1)
Gene Name F02A9.10
Sequence F02A9.10
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 15382/15383-15513/15514(131 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(14134..14450, 14496..14733, 14779..14933, 14985..15289, 15345..15942, 15989..16280, 16416..16524, 16573..16627))
Map position0.15
Balancer
Map position of balancer
Sequence of primersExtRev:TTGCTGGATACGAGGTAAAC,ExtFwd:GTAGCAAATCCGGTCACAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Lee YU, Fox BW, Guo R, Curtis BJ, Yu J, Kim S, Nanda S, Baumann V, Yilmaz LS, Haynes CM, Schroeder FC, Walhout AJM.
Host-microbe interactions rewire metabolism in a C. elegans model of leucine breakdown deficiency.
Nat Metab 2024 6(8) 1584-1600 
[ PubMed ID = 39117959 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]