Mutants (Isolated)

tm1231

Allele Nametm1231
Sequence NameZK593.4
CGC Namerbr-2
Worm BaseAllele Name tm1231
CGC Name rbr-2
Sequence ZK593.4
Phenotypehomozygous viable. Dr. S.S. Lee: no obvious developmental nor lifespan phenotype. Dr. M. Han: fertile, low penetrance multiple vulva. Dr. A. Salcini: Cell 128, 1063 (2007).
Mutation site12267/12268-12915/12916 (648 bp deletion)
ChromosomeIV
Putative gene structurejoin(10313..10456, 10507..10638, 10898..11334, 11563..11750, 11800..13810, 13974..14161, 14208..14503, 14935..15590, 15636..15934, 16314..16396)
Map position4.74
Balancer
Map position of balancer
Sequence of primersIntRev:GGCACTCTTGGCTGTATGAC,ExtRev:CGGCTCTCTGACATCGGGTT,IntFwd:GAGAGACGTTGCCCGCGAAT,ExtFwd:CCTTTACATTTCGTCCCCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Möller S, Saul N, Cohen AA, Köhling R, Sender S, Murua Escobar, Junghanss C, Cirulli F, Berry A, Antal P, Adler P, Vilo J, Boiani M, Jansen L, Repsilber D, Grabe HJ, Struckmann S, Barrantes I, Hamed M, Wouters B, Schoofs L, Luyten W, Fuellen G.
Healthspan pathway maps in C. elegans and humans highlight transcription, proliferation/biosynthesis and lipids.
Aging (Albany NY) 2020 12(13) 12534-12581 
[ PubMed ID = 32634117 ] [ RRC reference ]

Churgin MA, Szuperak M, Davis KC, Raizen DM, Fang-Yen C, Kayser MS.
Quantitative imaging of sleep behavior in Caenorhabditis elegans and larval Drosophila melanogaster.
Nat Protoc 2019 14(5) 1455-1488 
[ PubMed ID = 30953041 ] [ RRC reference ]

Moore RS, Kaletsky R, Murphy CT.
Piwi/PRG-1 Argonaute and TGF-β Mediate Transgenerational Learned Pathogenic Avoidance.
Cell 2019 177(7) 1827-1841.e12 
[ PubMed ID = 31178117 ] [ RRC reference ]

Bazopoulou D, Knoefler D, Zheng Y, Ulrich K, Oleson BJ, Xie L, Kim M, Kaufmann A, Lee YT, Dou Y, Chen Y, Quan S, Jakob U.
Developmental ROS individualizes organismal stress resistance and lifespan.
Nature 2019 576(7786) 301-305 
[ PubMed ID = 31801997 ] [ RRC reference ]

Herbette M, Robert V, Bailly A, Gely L, Feil R, Llères D, Palladino F.
A Role for Caenorhabditis elegans COMPASS in Germline Chromatin Organization.
Cells 2020 9(9)  
[ PubMed ID = 32911802 ] [ RRC reference ]

Lussi YC, Mariani L, Friis C, Peltonen J, Myers TR, Krag C, Wong G, Salcini AE.
Impaired removal of H3K4 methylation affects cell fate determination and gene transcription.
Development 2016 143(20) 3751-3762 
[ PubMed ID = 27578789 ] [ RRC reference ]

Greer EL, Maures TJ, Hauswirth AG, Green EM, Leeman DS, Maro GS, Han S, Banko MR, Gozani O, Brunet A.
Members of the H3K4 trimethylation complex regulate lifespan in a germline-dependent manner in C. elegans.
Nature 2010 466(7304) 383-7 
[ PubMed ID = 20555324 ] [ RRC reference ]

Greer EL, Maures TJ, Ucar D, Hauswirth AG, Mancini E, Lim JP, Benayoun BA, Shi Y, Brunet A.
Transgenerational epigenetic inheritance of longevity in Caenorhabditis elegans.
Nature 2011 479(7373) 365-71 
[ PubMed ID = 22012258 ] [ RRC reference ]

Käser-Pébernard S, Müller F, Wicky C.
LET-418/Mi2 and SPR-5/LSD1 cooperatively prevent somatic reprogramming of C. elegans germline stem cells.
Stem Cell Reports 2014 2(4) 547-59 
[ PubMed ID = 24749077 ] [ RRC reference ]

Nishibuchi G, Shibata Y, Hayakawa T, Hayakawa N, Ohtani Y, Sinmyozu K, Tagami H, Nakayama J.
Physical and functional interactions between the histone H3K4 demethylase KDM5A and the nucleosome remodeling and deacetylase (NuRD) complex.
J Biol Chem 2014 289(42) 28956-70 
[ PubMed ID = 25190814 ] [ RRC reference ]

Alvares SM, Mayberry GA, Joyner EY, Lakowski B, Ahmed S.
H3K4 demethylase activities repress proliferative and postmitotic aging.
Aging Cell 2014 13(2) 245-53 
[ PubMed ID = 24134677 ] [ RRC reference ]

Nono M, Kishimoto S, Sato-Carlton A, Carlton PM, Nishida E, Uno M.
Intestine-to-Germline Transmission of Epigenetic Information Intergenerationally Ensures Systemic Stress Resistance in C. elegans.
Cell Rep 2020 30(10) 3207-3217.e4 
[ PubMed ID = 32160530 ] [ RRC reference ]

Spichal M, Heestand B, Billmyre KK, Frenk S, Mello CC, Ahmed S.
Germ granule dysfunction is a hallmark and mirror of Piwi mutant sterility.
Nat Commun 2021 12(1) 1420 
[ PubMed ID = 33658512 ] [ RRC reference ]

Demoinet E, Li S, Roy R.
AMPK blocks starvation-inducible transgenerational defects in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2017 114(13) E2689-E2698 
[ PubMed ID = 28289190 ] [ RRC reference ]

Billmyre KK, Doebley AL, Spichal M, Heestand B, Belicard T, Sato-Carlton A, Flibotte S, Simon M, Gnazzo M, Skop A, Moerman D, Carlton PM, Sarkies P, Ahmed S.
The meiotic phosphatase GSP-2/PP1 promotes germline immortality and small RNA-mediated genome silencing.
PLoS Genet 2019 15(3) e1008004 
[ PubMed ID = 30921322 ] [ RRC reference ]

Wang S, Fisher K, Poulin GB.
Lineage specific trimethylation of H3 on lysine 4 during C. elegans early embryogenesis.
Dev Biol 2011 355(2) 227-38 
[ PubMed ID = 21549110 ] [ RRC reference ]

Han S, Schroeder EA, Silva-García CG, Hebestreit K, Mair WB, Brunet A.
Mono-unsaturated fatty acids link H3K4me3 modifiers to C. elegans lifespan.
Nature 2017 544(7649) 185-190 
[ PubMed ID = 28379943 ] [ RRC reference ]

Mariani L, Lussi YC, Vandamme J, Riveiro A, Salcini AE.
The H3K4me3/2 histone demethylase RBR-2 controls axon guidance by repressing the actin-remodeling gene wsp-1.
Development 2016 143(5) 851-63 
[ PubMed ID = 26811384 ] [ RRC reference ]

Christensen J, Agger K, Cloos PA, Pasini D, Rose S, Sennels L, Rappsilber J, Hansen KH, Salcini AE, Helin K.
RBP2 belongs to a family of demethylases, specific for tri-and dimethylated lysine 4 on histone 3.
Cell 2007 128(6) 1063-76 
[ PubMed ID = 17320161 ] [ RRC reference ]