Mutants (Isolated)

tm1231

Allele Nametm1231
Sequence NameZK593.4
CGC Namerbr-2
Worm BaseAllele Name tm1231
CGC Name rbr-2
Sequence ZK593.4
Phenotypehomozygous viable. Dr. S.S. Lee: no obvious developmental nor lifespan phenotype. Dr. M. Han: fertile, low penetrance multiple vulva. Dr. A. Salcini: Cell 128, 1063 (2007).
Mutation site12267/12268-12915/12916 (648 bp deletion)
ChromosomeIV
Putative gene structurejoin(10313..10456, 10507..10638, 10898..11334, 11563..11750, 11800..13810, 13974..14161, 14208..14503, 14935..15590, 15636..15934, 16314..16396)
Map position4.74
Balancer
Map position of balancer
Sequence of primersIntRev:GGCACTCTTGGCTGTATGAC,ExtRev:CGGCTCTCTGACATCGGGTT,IntFwd:GAGAGACGTTGCCCGCGAAT,ExtFwd:CCTTTACATTTCGTCCCCGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Christensen J, Agger K, Cloos PA, Pasini D, Rose S, Sennels L, Rappsilber J, Hansen KH, Salcini AE, Helin K.
RBP2 belongs to a family of demethylases, specific for tri-and dimethylated lysine 4 on histone 3.
Cell 2007 128(6) 1063-76 
[ PubMed ID = 17320161 ] [ RRC reference ]

Alvares SM, Mayberry GA, Joyner EY, Lakowski B, Ahmed S.
H3K4 demethylase activities repress proliferative and postmitotic aging.
Aging Cell 2014 13(2) 245-53 
[ PubMed ID = 24134677 ] [ RRC reference ]

Nishibuchi G, Shibata Y, Hayakawa T, Hayakawa N, Ohtani Y, Sinmyozu K, Tagami H, Nakayama J.
Physical and functional interactions between the histone H3K4 demethylase KDM5A and the nucleosome remodeling and deacetylase (NuRD) complex.
J. Biol. Chem. 2014 289(42) 28956-70 
[ PubMed ID = 25190814 ] [ RRC reference ]

Käser-Pébernard S, Müller F, Wicky C.
LET-418/Mi2 and SPR-5/LSD1 cooperatively prevent somatic reprogramming of C. elegans germline stem cells.
Stem Cell Reports 2014 2(4) 547-59 
[ PubMed ID = 24749077 ] [ RRC reference ]

Greer EL, Maures TJ, Ucar D, Hauswirth AG, Mancini E, Lim JP, Benayoun BA, Shi Y, Brunet A.
Transgenerational epigenetic inheritance of longevity in Caenorhabditis elegans.
Nature 2011 479(7373) 365-71 
[ PubMed ID = 22012258 ] [ RRC reference ]

Greer EL, Maures TJ, Hauswirth AG, Green EM, Leeman DS, Maro GS, Han S, Banko MR, Gozani O, Brunet A.
Members of the H3K4 trimethylation complex regulate lifespan in a germline-dependent manner in C. elegans.
Nature 2010 466(7304) 383-7 
[ PubMed ID = 20555324 ] [ RRC reference ]

Wang S, Fisher K, Poulin GB.
Lineage specific trimethylation of H3 on lysine 4 during C. elegans early embryogenesis.
Dev. Biol. 2011 355(2) 227-38 
[ PubMed ID = 21549110 ] [ RRC reference ]

Demoinet E, Li S, Roy R.
AMPK blocks starvation-inducible transgenerational defects in Caenorhabditis elegans.
Proc. Natl. Acad. Sci. U.S.A. 2017 114(13) E2689-E2698 
[ PubMed ID = 28289190 ] [ RRC reference ]

Han S, Schroeder EA, Silva-García CG, Hebestreit K, Mair WB, Brunet A.
Mono-unsaturated fatty acids link H3K4me3 modifiers to C. elegans lifespan.
Nature 2017 544(7649) 185-190 
[ PubMed ID = 28379943 ] [ RRC reference ]

Mariani L, Lussi YC, Vandamme J, Riveiro A, Salcini AE.
The H3K4me3/2 histone demethylase RBR-2 controls axon guidance by repressing the actin-remodeling gene wsp-1.
Development 2016 143(5) 851-63 
[ PubMed ID = 26811384 ] [ RRC reference ]