Mutants (Isolated)

tm1231

Allele Nametm1231
Allele TypeNormal
Sequence NameZK593.4
Gene Namerbr-2
Worm BaseAllele Name tm1231
Gene Name rbr-2
Sequence ZK593.4
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. S.S. Lee: no obvious developmental nor lifespan phenotype. Dr. M. Han: fertile, low penetrance multiple vulva. Dr. A. Salcini: Cell 128, 1063 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 12267/12268-12915/12916 (648 bp deletion)
ChromosomeIV
Putative gene structurejoin(10313..10456, 10507..10638, 10898..11334, 11563..11750, 11800..13810, 13974..14161, 14208..14503, 14935..15590, 15636..15934, 16314..16396)
Map position4.74
Balancer
Map position of balancer
Sequence of primersExtRev:CGGCTCTCTGACATCGGGTT,IntFwd:GAGAGACGTTGCCCGCGAAT,ExtFwd:CCTTTACATTTCGTCCCCGA,IntRev:GGCACTCTTGGCTGTATGAC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Murari E, Meadows D, Cuda N, Mangone M.
A comprehensive analysis of 3'UTRs in Caenorhabditis elegans.
Nucleic Acids Res 2024 52(13) 7523-7538 
[ PubMed ID = 38917330 ] [ RRC reference ]

Weng Y, Murphy CT.
Male-specific behavioral and transcriptomic changes in aging C. elegans neurons.
iScience 2024 27(6) 109910 
[ PubMed ID = 38783998 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69 
[ PubMed ID = 38164610 ] [ RRC reference ]

Xiao Y, Liu F, Kong Q, Zhu X, Wang H, Li S, Jiang N, Yu C, Yun L.
Metformin induces S-adenosylmethionine restriction to extend the Caenorhabditis elegans healthspan through H3K4me3 modifiers.
Aging Cell 2022 21(3) e13567 
[ PubMed ID = 35146893 ] [ RRC reference ]

Spichal M, Heestand B, Billmyre KK, Frenk S, Mello CC, Ahmed S.
Germ granule dysfunction is a hallmark and mirror of Piwi mutant sterility.
Nat Commun 2021 12(1) 1420 
[ PubMed ID = 33658512 ] [ RRC reference ]

Herbette M, Robert V, Bailly A, Gely L, Feil R, Llères D, Palladino F.
A Role for Caenorhabditis elegans COMPASS in Germline Chromatin Organization.
Cells 2020 9(9)  
[ PubMed ID = 32911802 ] [ RRC reference ]

Möller S, Saul N, Cohen AA, Köhling R, Sender S, Murua Escobar H, Junghanss C, Cirulli F, Berry A, Antal P, Adler P, Vilo J, Boiani M, Jansen L, Repsilber D, Grabe HJ, Struckmann S, Barrantes I, Hamed M, Wouters B, Schoofs L, Luyten W, Fuellen G.
Healthspan pathway maps in C. elegans and humans highlight transcription, proliferation/biosynthesis and lipids.
Aging (Albany NY) 2020 12(13) 12534-12581 
[ PubMed ID = 32634117 ] [ RRC reference ]

Nono M, Kishimoto S, Sato-Carlton A, Carlton PM, Nishida E, Uno M.
Intestine-to-Germline Transmission of Epigenetic Information Intergenerationally Ensures Systemic Stress Resistance in C. elegans.
Cell Rep 2020 30(10) 3207-3217.e4 
[ PubMed ID = 32160530 ] [ RRC reference ]

Moore RS, Kaletsky R, Murphy CT.
Piwi/PRG-1 Argonaute and TGF-β Mediate Transgenerational Learned Pathogenic Avoidance.
Cell 2019 177(7) 1827-1841.e12 
[ PubMed ID = 31178117 ] [ RRC reference ]

Churgin MA, Szuperak M, Davis KC, Raizen DM, Fang-Yen C, Kayser MS.
Quantitative imaging of sleep behavior in Caenorhabditis elegans and larval Drosophila melanogaster.
Nat Protoc 2019 14(5) 1455-1488 
[ PubMed ID = 30953041 ] [ RRC reference ]

Bazopoulou D, Knoefler D, Zheng Y, Ulrich K, Oleson BJ, Xie L, Kim M, Kaufmann A, Lee YT, Dou Y, Chen Y, Quan S, Jakob U.
Developmental ROS individualizes organismal stress resistance and lifespan.
Nature 2019 576(7786) 301-305 
[ PubMed ID = 31801997 ] [ RRC reference ]

Billmyre KK, Doebley AL, Spichal M, Heestand B, Belicard T, Sato-Carlton A, Flibotte S, Simon M, Gnazzo M, Skop A, Moerman D, Carlton PM, Sarkies P, Ahmed S.
The meiotic phosphatase GSP-2/PP1 promotes germline immortality and small RNA-mediated genome silencing.
PLoS Genet 2019 15(3) e1008004 
[ PubMed ID = 30921322 ] [ RRC reference ]

Demoinet E, Li S, Roy R.
AMPK blocks starvation-inducible transgenerational defects in Caenorhabditis elegans.
Proc Natl Acad Sci U S A 2017 114(13) E2689-E2698 
[ PubMed ID = 28289190 ] [ RRC reference ]

Lussi YC, Mariani L, Friis C, Peltonen J, Myers TR, Krag C, Wong G, Salcini AE.
Impaired removal of H3K4 methylation affects cell fate determination and gene transcription.
Development 2016 143(20) 3751-3762 
[ PubMed ID = 27578789 ] [ RRC reference ]

Han S, Schroeder EA, Silva-García CG, Hebestreit K, Mair WB, Brunet A.
Mono-unsaturated fatty acids link H3K4me3 modifiers to C. elegans lifespan.
Nature 2017 544(7649) 185-190 
[ PubMed ID = 28379943 ] [ RRC reference ]

Greer EL, Maures TJ, Hauswirth AG, Green EM, Leeman DS, Maro GS, Han S, Banko MR, Gozani O, Brunet A.
Members of the H3K4 trimethylation complex regulate lifespan in a germline-dependent manner in C. elegans.
Nature 2010 466(7304) 383-7 
[ PubMed ID = 20555324 ] [ RRC reference ]

Wang S, Fisher K, Poulin GB.
Lineage specific trimethylation of H3 on lysine 4 during C. elegans early embryogenesis.
Dev Biol 2011 355(2) 227-38 
[ PubMed ID = 21549110 ] [ RRC reference ]

Greer EL, Maures TJ, Ucar D, Hauswirth AG, Mancini E, Lim JP, Benayoun BA, Shi Y, Brunet A.
Transgenerational epigenetic inheritance of longevity in Caenorhabditis elegans.
Nature 2011 479(7373) 365-71 
[ PubMed ID = 22012258 ] [ RRC reference ]

Käser-Pébernard S, Müller F, Wicky C.
LET-418/Mi2 and SPR-5/LSD1 cooperatively prevent somatic reprogramming of C. elegans germline stem cells.
Stem Cell Reports 2014 2(4) 547-59 
[ PubMed ID = 24749077 ] [ RRC reference ]

Nishibuchi G, Shibata Y, Hayakawa T, Hayakawa N, Ohtani Y, Sinmyozu K, Tagami H, Nakayama J.
Physical and functional interactions between the histone H3K4 demethylase KDM5A and the nucleosome remodeling and deacetylase (NuRD) complex.
J Biol Chem 2014 289(42) 28956-70 
[ PubMed ID = 25190814 ] [ RRC reference ]