分離済み変異体

tm1227

Allele Nametm1227
BalanceCompleted
OutCrossNot Accepted
Sequence NameY37D8A.9
Gene Namemrg-1
Worm BaseAllele Name tm1227 (x1)
Gene Name mrg-1
Sequence Y37D8A.9
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" lethal or sterile. Dr. M. Han: early larval lethal. Dr. R. Plasterk: homozygous inviable and experiments terminated. Dr. W.G. Kelly: homozygous animals are normal with low level sterility and produce some dead progeny and sterile offspring. Dr.S. Strome: Development 134, 757 (2007).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 57558/57559-57959/57960 (401 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(54604..54753, 55898..56111, 57038..57186, 57246..57740))
Map position19.1
Balancer,tmC29[unc-49 (tmIs1259)]
Map position of balancer
Sequence of primersExtRev:GATGCAGTCCTTCTCGACGT,IntRev:CGACGTACCACTGATACATT,ExtFwd:CAGCGGTCTCGTTATGATGA,IntFwd:TCGGGTAGTTTCAGTCTCTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Huang X, Cheng P, Weng C, Xu Z, Zeng C, Xu Z, Chen X, Zhu C, Guang S, Feng X.
A chromodomain protein mediates heterochromatin-directed piRNA expression.
Proc Natl Acad Sci U S A 2021 118(27)  
[ PubMed ID = 34187893 ] [ RRC reference ]

Cabianca DS, Muñoz-Jiménez C, Kalck V, Gaidatzis D, Padeken J, Seeber A, Askjaer P, Gasser SM.
Active chromatin marks drive spatial sequestration of heterochromatin in C. elegans nuclei.
Nature 2019 569(7758) 734-739 
[ PubMed ID = 31118512 ] [ RRC reference ]

Hajduskova M, Baytek G, Kolundzic E, Gosdschan A, Kazmierczak M, Ofenbauer A, Beato Del Rosal ML, Herzog S, Ul Fatima N, Mertins P, Seelk-Müthel S, Tursun B.
MRG-1/MRG15 Is a Barrier for Germ Cell to Neuron Reprogramming in Caenorhabditis elegans.
Genetics 2019 211(1) 121-139 
[ PubMed ID = 30425042 ] [ RRC reference ]

Gupta P, Leahul L, Wang X, Wang C, Bakos B, Jasper K, Hansen D.
Proteasome regulation of the chromodomain protein MRG-1 controls the balance between proliferative fate and differentiation in the C. elegans germ line.
Development 2015 142(2) 291-302 
[ PubMed ID = 25564623 ] [ RRC reference ]

Xu J, Sun X, Jing Y, Wang M, Liu K, Jian Y, Yang M, Cheng Z, Yang C.
MRG-1 is required for genomic integrity in Caenorhabditis elegans germ cells.
Cell Res 2012 22(5) 886-902 
[ PubMed ID = 22212480 ] [ RRC reference ]

Takasaki T, Liu Z, Habara Y, Nishiwaki K, Nakayama J, Inoue K, Sakamoto H, Strome S.
MRG-1, an autosome-associated protein, silences X-linked genes and protects germline immortality in Caenorhabditis elegans.
Development 2007 134(4) 757-67 
[ PubMed ID = 17215300 ] [ RRC reference ]