Mutants (Isolated)

tm1227

Allele Nametm1227
Sequence NameY37D8A.9
CGC Namemrg-1
Worm BaseAllele Name tm1227
CGC Name mrg-1
Sequence Y37D8A.9
Phenotypelethal or sterile. Dr. M. Han: early larval lethal. Dr. R. Plasterk: homozygous inviable and experiments terminated. Dr. W.G. Kelly: homozygous animals are normal with low level sterility and produce some dead progeny and sterile offspring. Dr.S. Strome: Development 134, 757 (2007).
Mutation site57558/57559-57959/57960 (401 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(54604..54753, 55898..56111, 57038..57186, 57246..57740))
Map position19.1
BalancerNot Yet Balanced
Map position of balancer
Sequence of primersExtFwd:CAGCGGTCTCGTTATGATGA,IntRev:CGACGTACCACTGATACATT,IntFwd:TCGGGTAGTTTCAGTCTCTA,ExtRev:GATGCAGTCCTTCTCGACGT
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Takasaki T, Liu Z, Habara Y, Nishiwaki K, Nakayama J, Inoue K, Sakamoto H, Strome S.
MRG-1, an autosome-associated protein, silences X-linked genes and protects germline immortality in Caenorhabditis elegans.
Development 2007 134(4) 757-67 
[ PubMed ID = 17215300 ] [ RRC reference ]

Gupta P, Leahul L, Wang X, Wang C, Bakos B, Jasper K, Hansen D.
Proteasome regulation of the chromodomain protein MRG-1 controls the balance between proliferative fate and differentiation in the C. elegans germ line.
Development 2015 142(2) 291-302 
[ PubMed ID = 25564623 ] [ RRC reference ]

Xu J, Sun X, Jing Y, Wang M, Liu K, Jian Y, Yang M, Cheng Z, Yang C.
MRG-1 is required for genomic integrity in Caenorhabditis elegans germ cells.
Cell Res. 2012 22(5) 886-902 
[ PubMed ID = 22212480 ] [ RRC reference ]