Mutants (Isolated)

tm1200

Allele Nametm1200
Sequence NameC16C10.3
CGC Namehrde-1
Worm BaseAllele Name tm1200
CGC Name hrde-1
Sequence C16C10.3
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site32390/32391-32764/32765 (374 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(30115..30274, 30324..30514, 30560..31508, 31556..32080, 32130..33083, 33129..33339, 33391..33499))
Map position-3.71
Balancer
Map position of balancer
Sequence of primersIntRev:CAACAGGATTCCCAAACGAG,ExtRev:CATGGCCGACTTGCTCGACA,IntFwd:ACGTTCGACTTACTCGGCCT,ExtFwd:TTGGACAGCTTGTCGCAGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Lev I, Bril R, Liu Y, Ceré LI, Rechavi O.
Inter-generational consequences for growing Caenorhabditis elegans in liquid.
Philos. Trans. R. Soc. Lond., B, Biol. Sci. 2019 374(1770) 20180125 
[ PubMed ID = 30966881 ] [ RRC reference ]

Perales R, Pagano D, Wan G, Fields BD, Saltzman AL, Kennedy SG.
Transgenerational Epigenetic Inheritance Is Negatively Regulated by the HERI-1 Chromodomain Protein.
Genetics 2018 210(4) 1287-1299 
[ PubMed ID = 30389807 ] [ RRC reference ]

Posner R, Toker IA, Antonova O, Star E, Anava S, Azmon E, Hendricks M, Bracha S, Gingold H, Rechavi O.
Neuronal Small RNAs Control Behavior Transgenerationally.
Cell 2019 177(7) 1814-1826.e15 
[ PubMed ID = 31178120 ] [ RRC reference ]

Moore RS, Kaletsky R, Murphy CT.
Piwi/PRG-1 Argonaute and TGF-β Mediate Transgenerational Learned Pathogenic Avoidance.
Cell 2019 177(7) 1827-1841.e12 
[ PubMed ID = 31178117 ] [ RRC reference ]

Jordan JM, Hibshman JD, Webster AK, Kaplan REW, Leinroth A, Guzman R, Maxwell CS, Chitrakar R, Bowman EA, Fry AL, Hubbard EJA, Baugh LR.
Insulin/IGF Signaling and Vitellogenin Provisioning Mediate Intergenerational Adaptation to Nutrient Stress.
Curr. Biol. 2019 29(14) 2380-2388.e5 
[ PubMed ID = 31280992 ] [ RRC reference ]

Ni JZ, Kalinava N, Mendoza SG, Gu SG.
The spatial and temporal dynamics of nuclear RNAi-targeted retrotransposon transcripts in Caenorhabditis elegans.
Development 2018 145(20)  
[ PubMed ID = 30254142 ] [ RRC reference ]

Chow YL, Sato F.
Transgenerational lipid-reducing activity of benzylisoquinoline alkaloids in Caenorhabditis elegans.
Genes Cells 2019 24(1) 70-81 
[ PubMed ID = 30451341 ] [ RRC reference ]

Ni JZ, Kalinava N, Chen E, Huang A, Trinh T, Gu SG.
A transgenerational role of the germline nuclear RNAi pathway in repressing heat stress-induced transcriptional activation in C. elegans.
Epigenetics Chromatin 2016 9 3 
[ PubMed ID = 26779286 ] [ RRC reference ]

Minkina O, Hunter CP.
Stable Heritable Germline Silencing Directs Somatic Silencing at an Endogenous Locus.
Mol. Cell 2017 65(4) 659-670.e5 
[ PubMed ID = 28212751 ] [ RRC reference ]

Zhou X, Feng X, Mao H, Li M, Xu F, Hu K, Guang S.
RdRP-synthesized antisense ribosomal siRNAs silence pre-rRNA via the nuclear RNAi pathway.
Nat. Struct. Mol. Biol. 2017 24(3) 258-269 
[ PubMed ID = 28165511 ] [ RRC reference ]

Akay A, Di Domenico T, Suen KM, Nabih A, Parada GE, Larance M, Medhi R, Berkyurek AC, Zhang X, Wedeles CJ, Rudolph KLM, Engelhardt J, Hemberg M, Ma P, Lamond AI, Claycomb JM, Miska EA.
The Helicase Aquarius/EMB-4 Is Required to Overcome Intronic Barriers to Allow Nuclear RNAi Pathways to Heritably Silence Transcription.
Dev. Cell 2017 42(3) 241-255.e6 
[ PubMed ID = 28787591 ] [ RRC reference ]

Nono M, Kishimoto S, Sato-Carlton A, Carlton PM, Nishida E, Uno M.
Intestine-to-Germline Transmission of Epigenetic Information Intergenerationally Ensures Systemic Stress Resistance in C. elegans.
Cell Rep 2020 30(10) 3207-3217.e4 
[ PubMed ID = 32160530 ] [ RRC reference ]

Kadekar P, Roy R.
AMPK regulates germline stem cell quiescence and integrity through an endogenous small RNA pathway.
PLoS Biol. 2019 17(6) e3000309 
[ PubMed ID = 31166944 ] [ RRC reference ]

Gushchanskaia ES, Esse R, Ma Q, Lau NC, Grishok A.
Interplay between small RNA pathways shapes chromatin landscapes in C. elegans.
Nucleic Acids Res. 2019 47(11) 5603-5616 
[ PubMed ID = 31216042 ] [ RRC reference ]

Tyc KM, Nabih A, Wu MZ, Wedeles CJ, Sobotka JA, Claycomb JM.
The Conserved Intron Binding Protein EMB-4 Plays Differential Roles in Germline Small RNA Pathways of C. elegans.
Dev. Cell 2017 42(3) 256-270.e6 
[ PubMed ID = 28787592 ] [ RRC reference ]

Weiser NE, Yang DX, Feng S, Kalinava N, Brown KC, Khanikar J, Freeberg MA, Snyder MJ, Csankovszki G, Chan RC, Gu SG, Montgomery TA, Jacobsen SE, Kim JK.
MORC-1 Integrates Nuclear RNAi and Transgenerational Chromatin Architecture to Promote Germline Immortality.
Dev. Cell 2017 41(4) 408-423.e7 
[ PubMed ID = 28535375 ] [ RRC reference ]

Kalinava N, Ni JZ, Peterman K, Chen E, Gu SG.
Decoupling the downstream effects of germline nuclear RNAi reveals that H3K9me3 is dispensable for heritable RNAi and the maintenance of endogenous siRNA-mediated transcriptional silencing in Caenorhabditis elegans.
Epigenetics Chromatin 2017 10 6 
[ PubMed ID = 28228846 ] [ RRC reference ]

Rechavi O, Houri-Ze'evi L, Anava S, Goh WSS, Kerk SY, Hannon GJ, Hobert O.
Starvation-induced transgenerational inheritance of small RNAs in C. elegans.
Cell 2014 158(2) 277-287 
[ PubMed ID = 25018105 ] [ RRC reference ]

Ni JZ, Chen E, Gu SG.
Complex coding of endogenous siRNA, transcriptional silencing and H3K9 methylation on native targets of germline nuclear RNAi in C. elegans.
BMC Genomics 2014 15 1157 
[ PubMed ID = 25534009 ] [ RRC reference ]

Devanapally S, Ravikumar S, Jose AM.
Double-stranded RNA made in C. elegans neurons can enter the germline and cause transgenerational gene silencing.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(7) 2133-8 
[ PubMed ID = 25646479 ] [ RRC reference ]