Mutants (Isolated)

tm1200

Allele Nametm1200
Allele TypeNormal
Sequence NameC16C10.3
Gene Namehrde-1
Worm BaseAllele Name tm1200
Gene Name hrde-1
Sequence C16C10.3
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 32390/32391-32764/32765 (374 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(30115..30274, 30324..30514, 30560..31508, 31556..32080, 32130..33083, 33129..33339, 33391..33499))
Map position-3.71
Balancer
Map position of balancer
Sequence of primersIntRev:CAACAGGATTCCCAAACGAG,ExtRev:CATGGCCGACTTGCTCGACA,IntFwd:ACGTTCGACTTACTCGGCCT,ExtFwd:TTGGACAGCTTGTCGCAGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Wang SY, Kim K, O'Brown ZK, Levan A, Dodson AE, Kennedy SG, Chernoff C, Greer EL.
Hypoxia induces transgenerational epigenetic inheritance of small RNAs.
Cell Rep 2022 41(11) 111800 
[ PubMed ID = 36516753 ] [ RRC reference ]

Ouyang JPT, Zhang WL, Seydoux G.
The conserved helicase ZNFX-1 memorializes silenced RNAs in perinuclear condensates.
Nat Cell Biol 2022 24(7) 1129-1140 
[ PubMed ID = 35739318 ] [ RRC reference ]

Legüe M, Caneo M, Aguila B, Pollak B, Calixto A.
Interspecies effectors of a transgenerational memory of bacterial infection in Caenorhabditis elegans.
iScience 2022 25(7) 104627 
[ PubMed ID = 35800768 ] [ RRC reference ]

Zaghet N, Madsen K, Rossi F, Perez DF, Amendola PG, Demharter S, Pfisterer U, Khodosevich K, Pasini D, Salcini AE.
Coordinated maintenance of H3K36/K27 methylation by histone demethylases preserves germ cell identity and immortality.
Cell Rep 2021 37(8) 110050 
[ PubMed ID = 34818537 ] [ RRC reference ]

Toker IA, Lev I, Mor Y, Gurevich Y, Fisher D, Houri-Zeevi L, Antonova O, Doron H, Anava S, Gingold H, Hadany L, Shaham S, Rechavi O.
Transgenerational inheritance of sexual attractiveness via small RNAs enhances evolvability in C. elegans.
Dev Cell 2022 57(3) 298-309.e9 
[ PubMed ID = 35134343 ] [ RRC reference ]

Ow MC, Nichitean AM, Hall SE.
Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans.
Elife 2021 10  
[ PubMed ID = 34236316 ] [ RRC reference ]

Kim H, Ding YH, Zhang G, Yan YH, Conte D Jr, Dong MQ, Mello CC.
HDAC1 SUMOylation promotes Argonaute-directed transcriptional silencing in C. elegans.
Elife 2021 10  
[ PubMed ID = 34003109 ] [ RRC reference ]

Cornes E, Bourdon L, Singh M, Mueller F, Quarato P, Wernersson E, Bienko M, Li B, Cecere G.
piRNAs initiate transcriptional silencing of spermatogenic genes during C. elegans germline development.
Dev Cell 2022 57(2) 180-196.e7 
[ PubMed ID = 34921763 ] [ RRC reference ]

Spichal M, Heestand B, Billmyre KK, Frenk S, Mello CC, Ahmed S.
Germ granule dysfunction is a hallmark and mirror of Piwi mutant sterility.
Nat Commun 2021 12(1) 1420 
[ PubMed ID = 33658512 ] [ RRC reference ]

Berkyurek AC, Furlan G, Lampersberger L, Beltran T, Weick EM, Nischwitz E, Cunha Navarro I, Braukmann F, Akay A, Price J, Butter F, Sarkies P, Miska EA.
The RNA polymerase II subunit RPB-9 recruits the integrator complex to terminate Caenorhabditis elegans piRNA transcription.
EMBO J 2021 40(5) e105565 
[ PubMed ID = 33533030 ] [ RRC reference ]

Lister-Shimauchi EH, Dinh M, Maddox P, Ahmed S.
Gametes deficient for Pot1 telomere binding proteins alter levels of telomeric foci for multiple generations.
Commun Biol 2021 4(1) 158 
[ PubMed ID = 33542458 ] [ RRC reference ]

Qi W, Gromoff EDV, Xu F, Zhao Q, Yang W, Pfeifer D, Maier W, Long L, Baumeister R.
The secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans.
Nat Commun 2021 12(1) 1262 
[ PubMed ID = 33627668 ] [ RRC reference ]

Okabe E, Uno M, Kishimoto S, Nishida E.
Intertissue small RNA communication mediates the acquisition and inheritance of hormesis in Caenorhabditis elegans.
Commun Biol 2021 4(1) 207 
[ PubMed ID = 33594200 ] [ RRC reference ]

Placentino M, de Jesus Domingues AM, Schreier J, Dietz S, Hellmann S, de Albuquerque BF, Butter F, Ketting RF.
Intrinsically disordered protein PID-2 modulates Z granules and is required for heritable piRNA-induced silencing in the Caenorhabditis elegans embryo.
EMBO J 2021 40(3) e105280 
[ PubMed ID = 33231880 ] [ RRC reference ]

Wang Y, Weng C, Chen X, Zhou X, Huang X, Yan Y, Zhu C.
CDE-1 suppresses the production of risiRNA by coupling polyuridylation and degradation of rRNA.
BMC Biol 2020 18(1) 115 
[ PubMed ID = 32887607 ] [ RRC reference ]

Rogers AK, Phillips CM.
A Small-RNA-Mediated Feedback Loop Maintains Proper Levels of 22G-RNAs in C. elegans.
Cell Rep 2020 33(3) 108279 
[ PubMed ID = 33086057 ] [ RRC reference ]

Schwartz-Orbach L, Zhang C, Sidoli S, Amin R, Kaur D, Zhebrun A, Ni J, Gu SG.
Caenorhabditis elegans nuclear RNAi factor SET-32 deposits the transgenerational histone modification, H3K23me3.
Elife 2020 9  
[ PubMed ID = 32804637 ] [ RRC reference ]

Burton NO, Riccio C, Dallaire A, Price J, Jenkins B, Koulman A, Miska EA.
Cysteine synthases CYSL-1 and CYSL-2 mediate C. elegans heritable adaptation to P. vranovensis infection.
Nat Commun 2020 11(1) 1741 
[ PubMed ID = 32269224 ] [ RRC reference ]

Posner R, Toker IA, Antonova O, Star E, Anava S, Azmon E, Hendricks M, Bracha S, Gingold H, Rechavi O.
Neuronal Small RNAs Control Behavior Transgenerationally.
Cell 2019 177(7) 1814-1826.e15 
[ PubMed ID = 31178120 ] [ RRC reference ]

Ouyang JPT, Folkmann A, Bernard L, Lee CY, Seroussi U, Charlesworth AG, Claycomb JM, Seydoux G.
P Granules Protect RNA Interference Genes from Silencing by piRNAs.
Dev Cell 2019 50(6) 716-728.e6 
[ PubMed ID = 31402283 ] [ RRC reference ]