Mutants (Isolated)

tm1200

Allele Nametm1200
Sequence NameC16C10.3
CGC Namehrde-1
Worm BaseAllele Name tm1200
CGC Name hrde-1
Sequence C16C10.3
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site32390/32391-32764/32765 (374 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(30115..30274, 30324..30514, 30560..31508, 31556..32080, 32130..33083, 33129..33339, 33391..33499))
Map position-3.71
Balancer
Map position of balancer
Sequence of primersIntRev:CAACAGGATTCCCAAACGAG,ExtRev:CATGGCCGACTTGCTCGACA,IntFwd:ACGTTCGACTTACTCGGCCT,ExtFwd:TTGGACAGCTTGTCGCAGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Berkyurek AC, Furlan G, Lampersberger L, Beltran T, Weick EM, Nischwitz E, Cunha Navarro I, Braukmann F, Akay A, Price J, Butter F, Sarkies P, Miska EA.
The RNA polymerase II subunit RPB-9 recruits the integrator complex to terminate Caenorhabditis elegans piRNA transcription.
EMBO J 2021 40(5) e105565 
[ PubMed ID = 33533030 ] [ RRC reference ]

Schwartz-Orbach L, Zhang C, Sidoli S, Amin R, Kaur D, Zhebrun A, Ni J, Gu SG.
Caenorhabditis elegans nuclear RNAi factor SET-32 deposits the transgenerational histone modification, H3K23me3.
Elife 2020 9  
[ PubMed ID = 32804637 ] [ RRC reference ]

Burton NO, Riccio C, Dallaire A, Price J, Jenkins B, Koulman A, Miska EA.
Cysteine synthases CYSL-1 and CYSL-2 mediate C. elegans heritable adaptation to P. vranovensis infection.
Nat Commun 2020 11(1) 1741 
[ PubMed ID = 32269224 ] [ RRC reference ]

Okabe E, Uno M, Kishimoto S, Nishida E.
Intertissue small RNA communication mediates the acquisition and inheritance of hormesis in Caenorhabditis elegans.
Commun Biol 2021 4(1) 207 
[ PubMed ID = 33594200 ] [ RRC reference ]

Rogers AK, Phillips CM.
A Small-RNA-Mediated Feedback Loop Maintains Proper Levels of 22G-RNAs in C. elegans.
Cell Rep 2020 33(3) 108279 
[ PubMed ID = 33086057 ] [ RRC reference ]

Lev I, Bril R, Liu Y, Ceré LI, Rechavi O.
Inter-generational consequences for growing Caenorhabditis elegans in liquid.
Philos Trans R Soc Lond B Biol Sci 2019 374(1770) 20180125 
[ PubMed ID = 30966881 ] [ RRC reference ]

Barucci G, Cornes E, Singh M, Li B, Ugolini M, Samolygo A, Didier C, Dingli F, Loew D, Quarato P, Cecere G.
Small-RNA-mediated transgenerational silencing of histone genes impairs fertility in piRNA mutants.
Nat Cell Biol 2020 22(2) 235-245 
[ PubMed ID = 32015436 ] [ RRC reference ]

Perales R, Pagano D, Wan G, Fields BD, Saltzman AL, Kennedy SG.
Transgenerational Epigenetic Inheritance Is Negatively Regulated by the HERI-1 Chromodomain Protein.
Genetics 2018 210(4) 1287-1299 
[ PubMed ID = 30389807 ] [ RRC reference ]

Posner R, Toker IA, Antonova O, Star E, Anava S, Azmon E, Hendricks M, Bracha S, Gingold H, Rechavi O.
Neuronal Small RNAs Control Behavior Transgenerationally.
Cell 2019 177(7) 1814-1826.e15 
[ PubMed ID = 31178120 ] [ RRC reference ]

Moore RS, Kaletsky R, Murphy CT.
Piwi/PRG-1 Argonaute and TGF-β Mediate Transgenerational Learned Pathogenic Avoidance.
Cell 2019 177(7) 1827-1841.e12 
[ PubMed ID = 31178117 ] [ RRC reference ]

Jordan JM, Hibshman JD, Webster AK, Kaplan REW, Leinroth A, Guzman R, Maxwell CS, Chitrakar R, Bowman EA, Fry AL, Hubbard EJA, Baugh LR.
Insulin/IGF Signaling and Vitellogenin Provisioning Mediate Intergenerational Adaptation to Nutrient Stress.
Curr Biol 2019 29(14) 2380-2388.e5 
[ PubMed ID = 31280992 ] [ RRC reference ]

Ni JZ, Kalinava N, Mendoza SG, Gu SG.
The spatial and temporal dynamics of nuclear RNAi-targeted retrotransposon transcripts in Caenorhabditis elegans.
Development 2018 145(20)  
[ PubMed ID = 30254142 ] [ RRC reference ]

Chow YL, Sato F.
Transgenerational lipid-reducing activity of benzylisoquinoline alkaloids in Caenorhabditis elegans.
Genes Cells 2019 24(1) 70-81 
[ PubMed ID = 30451341 ] [ RRC reference ]

Ni JZ, Kalinava N, Chen E, Huang A, Trinh T, Gu SG.
A transgenerational role of the germline nuclear RNAi pathway in repressing heat stress-induced transcriptional activation in C. elegans.
Epigenetics Chromatin 2016 9 3 
[ PubMed ID = 26779286 ] [ RRC reference ]

Minkina O, Hunter CP.
Stable Heritable Germline Silencing Directs Somatic Silencing at an Endogenous Locus.
Mol Cell 2017 65(4) 659-670.e5 
[ PubMed ID = 28212751 ] [ RRC reference ]

Zhou X, Feng X, Mao H, Li M, Xu F, Hu K, Guang S.
RdRP-synthesized antisense ribosomal siRNAs silence pre-rRNA via the nuclear RNAi pathway.
Nat Struct Mol Biol 2017 24(3) 258-269 
[ PubMed ID = 28165511 ] [ RRC reference ]

Lister-Shimauchi EH, Dinh M, Maddox P, Ahmed S.
Gametes deficient for Pot1 telomere binding proteins alter levels of telomeric foci for multiple generations.
Commun Biol 2021 4(1) 158 
[ PubMed ID = 33542458 ] [ RRC reference ]

Qi W, Gromoff EDV, Xu F, Zhao Q, Yang W, Pfeifer D, Maier W, Long L, Baumeister R.
The secreted endoribonuclease ENDU-2 from the soma protects germline immortality in C. elegans.
Nat Commun 2021 12(1) 1262 
[ PubMed ID = 33627668 ] [ RRC reference ]

Akay A, Di Domenico T, Suen KM, Nabih A, Parada GE, Larance M, Medhi R, Berkyurek AC, Zhang X, Wedeles CJ, Rudolph KLM, Engelhardt J, Hemberg M, Ma P, Lamond AI, Claycomb JM, Miska EA.
The Helicase Aquarius/EMB-4 Is Required to Overcome Intronic Barriers to Allow Nuclear RNAi Pathways to Heritably Silence Transcription.
Dev Cell 2017 42(3) 241-255.e6 
[ PubMed ID = 28787591 ] [ RRC reference ]

Tyc KM, Nabih A, Wu MZ, Wedeles CJ, Sobotka JA, Claycomb JM.
The Conserved Intron Binding Protein EMB-4 Plays Differential Roles in Germline Small RNA Pathways of C. elegans.
Dev Cell 2017 42(3) 256-270.e6 
[ PubMed ID = 28787592 ] [ RRC reference ]