分離済み変異体

tm1200

Allele Name

tm1200

Allele Type

通常株

Sequence Name

C16C10.3

Gene Name

hrde-1

Worm Base

Allele Name

tm1200

Gene Name

hrde-1

Sequence

C16C10.3

Phenotype

homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).

Mutation site

32390/32391-32764/32765 (374 bp deletion)

Chromosome

III

Putative gene structure

complement(join(30115..30274, 30324..30514, 30560..31508, 31556..32080, 32130..33083, 33129..33339, 33391..33499))

Map position

-3.71

Balancer

Map position of balancer

Sequence of primers

IntRev:CAACAGGATTCCCAAACGAG,ExtRev:CATGGCCGACTTGCTCGACA,IntFwd:ACGTTCGACTTACTCGGCCT,ExtFwd:TTGGACAGCTTGTCGCAGAA

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Villalobos TV, Ghosh B, DeLeo KR, Alam S, Ricaurte-Perez C, Wang A, Mercola BM, Butsch TJ, Ramos CD, Das S, Eymard ED, Bohnert KA, Johnson AE.
Tubular lysosome induction couples animal starvation to healthy aging.
Nat Aging 2023 3(9) 1091-1106
[ PubMed ID = 37580394 ] [ RRC reference ]

Saredi G, Carelli FN, Rolland SGM, Furlan G, Piquet S, Appert A, Sanchez-Pulido L, Price JL, Alcon P, Lampersberger L, Déclais AC, Ramakrishna NB, Toth R, Macartney T, Alabert C, Ponting CP, Polo SE, Miska EA, Gartner A, Ahringer J, Rouse J.
The histone chaperone SPT2 regulates chromatin structure and function in Metazoa.
Nat Struct Mol Biol 2024 31(3) 523-535
[ PubMed ID = 38238586 ] [ RRC reference ]

Brown JS, Zhang D, Gaylord O, Chen W, Lee HC.
Sensitized piRNA reporter identifies multiple RNA processing factors involved in piRNA-mediated gene silencing.
Genetics 2023 224(4)
[ PubMed ID = 37210214 ] [ RRC reference ]

Gaeta AL, Willicott K, Willicott CW, McKay LE, Keogh CM, Altman TJ, Kimble LC, Yarbrough AL, Caldwell KA, Caldwell GA.
Mechanistic impacts of bacterial diet on dopaminergic neurodegeneration in a Caenorhabditis elegans α-synuclein model of Parkinson's disease.
iScience 2023 26(6) 106859
[ PubMed ID = 37260751 ] [ RRC reference ]

Abay-Nørgaard S, Tapia MC, Zeijdner M, Kim JH, Won KJ, Porse B, Salcini AE.
Inter and transgenerational impact of H3K4 methylation in neuronal homeostasis.
Life Sci Alliance 2023 6(8)
[ PubMed ID = 37225426 ] [ RRC reference ]

Deshe N, Eliezer Y, Hoch L, Itskovits E, Bokman E, Ben-Ezra S, Zaslaver A.
Inheritance of associative memories and acquired cellular changes in C. elegans.
Nat Commun 2023 14(1) 4232
[ PubMed ID = 37454110 ] [ RRC reference ]

Chen S, Phillips CM.
HRDE-2 drives small RNA specificity for the nuclear Argonaute protein HRDE-1.
Nat Commun 2024 15(1) 957
[ PubMed ID = 38302462 ] [ RRC reference ]

Du Z, Shi K, Brown JS, He T, Wu WS, Zhang Y, Lee HC, Zhang D.
Condensate cooperativity underlies transgenerational gene silencing.
Cell Rep 2023 42(8) 112859
[ PubMed ID = 37505984 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Wang W, Sherry T, Cheng X, Fan Q, Cornell R, Liu J, Xiao Z, Pocock R.
An intestinal sphingolipid confers intergenerational neuroprotection.
Nat Cell Biol 2023 25(8) 1196-1207
[ PubMed ID = 37537365 ] [ RRC reference ]

Sengupta T, St Ange J, Kaletsky R, Moore RS, Seto RJ, Marogi J, Myhrvold C, Gitai Z, Murphy CT.
A natural bacterial pathogen of C. elegans uses a small RNA to induce transgenerational inheritance of learned avoidance.
PLoS Genet 2024 20(3) e1011178
[ PubMed ID = 38547071 ] [ RRC reference ]

Wang SY, Kim K, O'Brown ZK, Levan A, Dodson AE, Kennedy SG, Chernoff C, Greer EL.
Hypoxia induces transgenerational epigenetic inheritance of small RNAs.
Cell Rep 2022 41(11) 111800
[ PubMed ID = 36516753 ] [ RRC reference ]

Ouyang JPT, Zhang WL, Seydoux G.
The conserved helicase ZNFX-1 memorializes silenced RNAs in perinuclear condensates.
Nat Cell Biol 2022 24(7) 1129-1140
[ PubMed ID = 35739318 ] [ RRC reference ]

Legüe M, Caneo M, Aguila B, Pollak B, Calixto A.
Interspecies effectors of a transgenerational memory of bacterial infection in Caenorhabditis elegans.
iScience 2022 25(7) 104627
[ PubMed ID = 35800768 ] [ RRC reference ]

Zaghet N, Madsen K, Rossi F, Perez DF, Amendola PG, Demharter S, Pfisterer U, Khodosevich K, Pasini D, Salcini AE.
Coordinated maintenance of H3K36/K27 methylation by histone demethylases preserves germ cell identity and immortality.
Cell Rep 2021 37(8) 110050
[ PubMed ID = 34818537 ] [ RRC reference ]

Toker IA, Lev I, Mor Y, Gurevich Y, Fisher D, Houri-Zeevi L, Antonova O, Doron H, Anava S, Gingold H, Hadany L, Shaham S, Rechavi O.
Transgenerational inheritance of sexual attractiveness via small RNAs enhances evolvability in C. elegans.
Dev Cell 2022 57(3) 298-309.e9
[ PubMed ID = 35134343 ] [ RRC reference ]

Ow MC, Nichitean AM, Hall SE.
Somatic aging pathways regulate reproductive plasticity in Caenorhabditis elegans.
Elife 2021 10
[ PubMed ID = 34236316 ] [ RRC reference ]

Kim H, Ding YH, Zhang G, Yan YH, Conte D Jr, Dong MQ, Mello CC.
HDAC1 SUMOylation promotes Argonaute-directed transcriptional silencing in C. elegans.
Elife 2021 10
[ PubMed ID = 34003109 ] [ RRC reference ]

Cornes E, Bourdon L, Singh M, Mueller F, Quarato P, Wernersson E, Bienko M, Li B, Cecere G.
piRNAs initiate transcriptional silencing of spermatogenic genes during C. elegans germline development.
Dev Cell 2022 57(2) 180-196.e7
[ PubMed ID = 34921763 ] [ RRC reference ]

Spichal M, Heestand B, Billmyre KK, Frenk S, Mello CC, Ahmed S.
Germ granule dysfunction is a hallmark and mirror of Piwi mutant sterility.
Nat Commun 2021 12(1) 1420
[ PubMed ID = 33658512 ] [ RRC reference ]