Mutants (Isolated)

tm1200

Allele Nametm1200
Sequence NameC16C10.3
CGC Namehrde-1
Worm BaseAllele Name tm1200
CGC Name hrde-1
Sequence C16C10.3
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site32390/32391-32764/32765 (374 bp deletion)
ChromosomeIII
Putative gene structurecomplement(join(30115..30274, 30324..30514, 30560..31508, 31556..32080, 32130..33083, 33129..33339, 33391..33499))
Map position-3.71
Balancer
Map position of balancer
Sequence of primersIntRev:CAACAGGATTCCCAAACGAG,ExtRev:CATGGCCGACTTGCTCGACA,IntFwd:ACGTTCGACTTACTCGGCCT,ExtFwd:TTGGACAGCTTGTCGCAGAA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Ashe A, Sapetschnig A, Weick EM, Mitchell J, Bagijn MP, Cording AC, Doebley AL, Goldstein LD, Lehrbach NJ, Le Pen J, Pintacuda G, Sakaguchi A, Sarkies P, Ahmed S, Miska EA.
piRNAs can trigger a multigenerational epigenetic memory in the germline of C. elegans.
Cell 2012 150(1) 88-99 
[ PubMed ID = 22738725 ] [ RRC reference ]

Akay A, Di Domenico T, Suen KM, Nabih A, Parada GE, Larance M, Medhi R, Berkyurek AC, Zhang X, Wedeles CJ, Rudolph KLM, Engelhardt J, Hemberg M, Ma P, Lamond AI, Claycomb JM, Miska EA.
The Helicase Aquarius/EMB-4 Is Required to Overcome Intronic Barriers to Allow Nuclear RNAi Pathways to Heritably Silence Transcription.
Dev. Cell 2017 42(3) 241-255.e6 
[ PubMed ID = 28787591 ] [ RRC reference ]

de Albuquerque BF, Luteijn MJ, Cordeiro Rodrigues RJ, van Bergeijk P, Waaijers S, Kaaij LJ, Klein H, Boxem M, Ketting RF.
PID-1 is a novel factor that operates during 21U-RNA biogenesis in Caenorhabditis elegans.
Genes Dev. 2014 28(7) 683-8 
[ PubMed ID = 24696453 ] [ RRC reference ]

Devanapally S, Ravikumar S, Jose AM.
Double-stranded RNA made in C. elegans neurons can enter the germline and cause transgenerational gene silencing.
Proc. Natl. Acad. Sci. U.S.A. 2015 112(7) 2133-8 
[ PubMed ID = 25646479 ] [ RRC reference ]

Ni JZ, Chen E, Gu SG.
Complex coding of endogenous siRNA, transcriptional silencing and H3K9 methylation on native targets of germline nuclear RNAi in C. elegans.
BMC Genomics 2014 15 1157 
[ PubMed ID = 25534009 ] [ RRC reference ]

Rechavi O, Houri-Ze'evi L, Anava S, Goh WSS, Kerk SY, Hannon GJ, Hobert O.
Starvation-induced transgenerational inheritance of small RNAs in C. elegans.
Cell 2014 158(2) 277-287 
[ PubMed ID = 25018105 ] [ RRC reference ]

Buckley BA, Burkhart KB, Gu SG, Spracklin G, Kershner A, Fritz H, Kimble J, Fire A, Kennedy S.
A nuclear Argonaute promotes multigenerational epigenetic inheritance and germline immortality.
Nature 2012 489(7416) 447-51 
[ PubMed ID = 22810588 ] [ RRC reference ]

Kalinava N, Ni JZ, Peterman K, Chen E, Gu SG.
Decoupling the downstream effects of germline nuclear RNAi reveals that H3K9me3 is dispensable for heritable RNAi and the maintenance of endogenous siRNA-mediated transcriptional silencing in Caenorhabditis elegans.
Epigenetics Chromatin 2017 10 6 
[ PubMed ID = 28228846 ] [ RRC reference ]

Weiser NE, Yang DX, Feng S, Kalinava N, Brown KC, Khanikar J, Freeberg MA, Snyder MJ, Csankovszki G, Chan RC, Gu SG, Montgomery TA, Jacobsen SE, Kim JK.
MORC-1 Integrates Nuclear RNAi and Transgenerational Chromatin Architecture to Promote Germline Immortality.
Dev. Cell 2017 41(4) 408-423.e7 
[ PubMed ID = 28535375 ] [ RRC reference ]

Tyc KM, Nabih A, Wu MZ, Wedeles CJ, Sobotka JA, Claycomb JM.
The Conserved Intron Binding Protein EMB-4 Plays Differential Roles in Germline Small RNA Pathways of C. elegans.
Dev. Cell 2017 42(3) 256-270.e6 
[ PubMed ID = 28787592 ] [ RRC reference ]

Robert VJ, Mercier MG, Bedet C, Janczarski S, Merlet J, Garvis S, Ciosk R, Palladino F.
The SET-2/SET1 histone H3K4 methyltransferase maintains pluripotency in the Caenorhabditis elegans germline.
Cell Rep 2014 9(2) 443-50 
[ PubMed ID = 25310986 ] [ RRC reference ]

Wedeles CJ, Wu MZ, Claycomb JM.
Protection of germline gene expression by the C. elegans Argonaute CSR-1.
Dev. Cell 2013 27(6) 664-71 
[ PubMed ID = 24360783 ] [ RRC reference ]

Spracklin G, Fields B, Wan G, Becker D, Wallig A, Shukla A, Kennedy S.
The RNAi Inheritance Machinery of Caenorhabditis elegans.
Genetics 2017 206(3) 1403-1416 
[ PubMed ID = 28533440 ] [ RRC reference ]

Shirayama M, Seth M, Lee HC, Gu W, Ishidate T, Conte D Jr, Mello CC.
piRNAs initiate an epigenetic memory of nonself RNA in the C. elegans germline.
Cell 2012 150(1) 65-77 
[ PubMed ID = 22738726 ] [ RRC reference ]

Luteijn MJ, van Bergeijk P, Kaaij LJ, Almeida MV, Roovers EF, Berezikov E, Ketting RF.
Extremely stable Piwi-induced gene silencing in Caenorhabditis elegans.
EMBO J. 2012 31(16) 3422-30 
[ PubMed ID = 22850670 ] [ RRC reference ]

Wu X, Shi Z, Cui M, Han M, Ruvkun G.
Repression of germline RNAi pathways in somatic cells by retinoblastoma pathway chromatin complexes.
PLoS Genet. 2012 8(3) e1002542 
[ PubMed ID = 22412383 ] [ RRC reference ]

Kim KW, Tang NH, Andrusiak MG, Wu Z, Chisholm AD, Jin Y.
A Neuronal piRNA Pathway Inhibits Axon Regeneration in C. elegans.
Neuron 2018 97(3) 511-519.e6 
[ PubMed ID = 29395906 ] [ RRC reference ]

Hall SE, Chirn GW, Lau NC, Sengupta P.
RNAi pathways contribute to developmental history-dependent phenotypic plasticity in C. elegans.
RNA 2013 19(3) 306-19 
[ PubMed ID = 23329696 ] [ RRC reference ]

Zhou X, Xu F, Mao H, Ji J, Yin M, Feng X, Guang S.
Nuclear RNAi contributes to the silencing of off-target genes and repetitive sequences in Caenorhabditis elegans.
Genetics 2014 197(1) 121-32 
[ PubMed ID = 24532782 ] [ RRC reference ]

Palominos MF, Verdugo L, Gabaldon C, Pollak B, Ortíz-Severín J, Varas MA, Chávez FP, Calixto A.
Transgenerational Diapause as an Avoidance Strategy against Bacterial Pathogens in Caenorhabditis elegans.
MBio 2017 8(5)  
[ PubMed ID = 29018118 ] [ RRC reference ]