分離済み変異体

tm1200

Allele Name

tm1200

Balance

Not Required

OutCross

Not Accepted

Sequence Name

C16C10.3

Gene Name

hrde-1

Worm Base

Allele Name

tm1200

Gene Name

hrde-1

Sequence

C16C10.3

Phenotype

homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).

Mutation site

32390/32391-32764/32765 (374 bp deletion)

Chromosome

III

Putative gene structure

complement(join(30115..30274, 30324..30514, 30560..31508, 31556..32080, 32130..33083, 33129..33339, 33391..33499))

Map position

-3.71

Balancer

Map position of balancer

Sequence of primers

IntRev:CAACAGGATTCCCAAACGAG,ExtRev:CATGGCCGACTTGCTCGACA,IntFwd:ACGTTCGACTTACTCGGCCT,ExtFwd:TTGGACAGCTTGTCGCAGAA

Distributed lab

Depositor

Dr. S. Mitani

References

Please submit your publication

Serey M, Retamales E, Ibañez G, Riadi G, Orio P, Castillo JP, Calixto A.
Interspecies relationships of natural amoebae and bacteria with C. elegans create environments propitious for multigenerational diapause.
mSystems 2025 10(4) e0156624
[ PubMed ID = 40111038 ] [ RRC reference ]

Gainey DP, Shubin AV, Hunter CP.
Reported transgenerational responses to Pseudomonas aeruginosa in Caenorhabditis elegans are not robust.
Elife 2025 13
[ PubMed ID = 40135732 ] [ RRC reference ]

Zhebrun A, Ni JZ, Corveleyn L, Roy SG, Sidoli S, Gu SG.
Two H3K23 histone methyltransferases, SET-32 and SET-21, function synergistically to promote nuclear RNAi-mediated transgenerational epigenetic inheritance in Caenorhabditis elegans.
bioRxiv 2024
[ PubMed ID = 39574755 ] [ RRC reference ]

Zhao C, Cai S, Shi R, Li X, Deng B, Li R, Yang S, Huang J, Liang Y, Lu P, Yuan Z, Jia H, Jiang Z, Zhang X, Kennedy S, Wan G.
HERD-1 mediates multiphase condensate immiscibility to regulate small RNA-driven transgenerational epigenetic inheritance.
Nat Cell Biol 2024 26(11) 1958-1970
[ PubMed ID = 39354132 ] [ RRC reference ]

Gainey DP, Shubin AV, Hunter CP.
Reported transgenerational responses to Pseudomonas aeruginosa in C. elegans are not robust.
bioRxiv 2024
[ PubMed ID = 39554072 ] [ RRC reference ]

Zhou L, Jiang L, Li L, Ma C, Xia P, Ding W, Liu Y.
A germline-to-soma signal triggers an age-related decline of mitochondrial stress response.
Nat Commun 2024 15(1) 8723
[ PubMed ID = 39379393 ] [ RRC reference ]

Huang X, Ye Q, Dai W, Zheng J, Li Y, Wang C, Luo Z, Yang J, Zhuo W, Wan QL.
Cadmium exposure induces multigenerational inheritance of germ cell apoptosis and fertility suppression in Caenorhabditis elegans.
Environ Int 2024 191 108952
[ PubMed ID = 39159515 ] [ RRC reference ]

Sengupta T, St Ange J, Kaletsky R, Moore RS, Seto RJ, Marogi J, Myhrvold C, Gitai Z, Murphy CT.
A natural bacterial pathogen of C. elegans uses a small RNA to induce transgenerational inheritance of learned avoidance.
PLoS Genet 2024 20(3) e1011178
[ PubMed ID = 38547071 ] [ RRC reference ]

Saredi G, Carelli FN, Rolland SGM, Furlan G, Piquet S, Appert A, Sanchez-Pulido L, Price JL, Alcon P, Lampersberger L, Déclais AC, Ramakrishna NB, Toth R, Macartney T, Alabert C, Ponting CP, Polo SE, Miska EA, Gartner A, Ahringer J, Rouse J.
The histone chaperone SPT2 regulates chromatin structure and function in Metazoa.
Nat Struct Mol Biol 2024 31(3) 523-535
[ PubMed ID = 38238586 ] [ RRC reference ]

Mazzetto M, Gonzalez LE, Sanchez N, Reinke V.
Characterization of the distribution and dynamics of chromatin states in the C. elegans germline reveals substantial H3K4me3 remodeling during oogenesis.
Genome Res 2024 34(1) 57-69
[ PubMed ID = 38164610 ] [ RRC reference ]

Chen S, Phillips CM.
HRDE-2 drives small RNA specificity for the nuclear Argonaute protein HRDE-1.
Nat Commun 2024 15(1) 957
[ PubMed ID = 38302462 ] [ RRC reference ]

Ow MC, Nishiguchi MA, Dar AR, Butcher RA, Hall SE.
RNAi-dependent expression of sperm genes in ADL chemosensory neurons is required for olfactory responses in Caenorhabditis elegans.
Front Mol Biosci 2024 11 1396587
[ PubMed ID = 39055986 ] [ RRC reference ]

Villalobos TV, Ghosh B, DeLeo KR, Alam S, Ricaurte-Perez C, Wang A, Mercola BM, Butsch TJ, Ramos CD, Das S, Eymard ED, Bohnert KA, Johnson AE.
Tubular lysosome induction couples animal starvation to healthy aging.
Nat Aging 2023 3(9) 1091-1106
[ PubMed ID = 37580394 ] [ RRC reference ]

Du Z, Shi K, Brown JS, He T, Wu WS, Zhang Y, Lee HC, Zhang D.
Condensate cooperativity underlies transgenerational gene silencing.
Cell Rep 2023 42(8) 112859
[ PubMed ID = 37505984 ] [ RRC reference ]

Brown JS, Zhang D, Gaylord O, Chen W, Lee HC.
Sensitized piRNA reporter identifies multiple RNA processing factors involved in piRNA-mediated gene silencing.
Genetics 2023 224(4)
[ PubMed ID = 37210214 ] [ RRC reference ]

Wang W, Sherry T, Cheng X, Fan Q, Cornell R, Liu J, Xiao Z, Pocock R.
An intestinal sphingolipid confers intergenerational neuroprotection.
Nat Cell Biol 2023 25(8) 1196-1207
[ PubMed ID = 37537365 ] [ RRC reference ]

Abay-Nørgaard S, Tapia MC, Zeijdner M, Kim JH, Won KJ, Porse B, Salcini AE.
Inter and transgenerational impact of H3K4 methylation in neuronal homeostasis.
Life Sci Alliance 2023 6(8)
[ PubMed ID = 37225426 ] [ RRC reference ]

Deshe N, Eliezer Y, Hoch L, Itskovits E, Bokman E, Ben-Ezra S, Zaslaver A.
Inheritance of associative memories and acquired cellular changes in C. elegans.
Nat Commun 2023 14(1) 4232
[ PubMed ID = 37454110 ] [ RRC reference ]

Gaeta AL, Willicott K, Willicott CW, McKay LE, Keogh CM, Altman TJ, Kimble LC, Yarbrough AL, Caldwell KA, Caldwell GA.
Mechanistic impacts of bacterial diet on dopaminergic neurodegeneration in a Caenorhabditis elegans α-synuclein model of Parkinson's disease.
iScience 2023 26(6) 106859
[ PubMed ID = 37260751 ] [ RRC reference ]

Wang SY, Kim K, O'Brown ZK, Levan A, Dodson AE, Kennedy SG, Chernoff C, Greer EL.
Hypoxia induces transgenerational epigenetic inheritance of small RNAs.
Cell Rep 2022 41(11) 111800
[ PubMed ID = 36516753 ] [ RRC reference ]