Mutants (Isolated)

tm1180

Allele Nametm1180
Sequence NameB0205.3
CGC Namerpn-10
Worm BaseAllele Name tm1180
CGC Name rpn-10
Sequence B0205.3
Phenotypehomozygous viable. Dr. H. Kawahara: Mol. Biol. Cell 17, 5356-5371 (2006). Dr. T. Ogura: Genes to Cells: 12, 1063 (2007). Dr. M. Gotta: Genetics 174, 285 (2006).
Mutation site25624/25625-25981/25982 (357 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(24954..25325, 25379..25880, 26200..26340, 26392..26450, 26867..27190, 27239..27363, 27414..27579, 27625..27690, 27840..27911))
Map position5.06
Balancer
Map position of balancer
Sequence of primersIntRev:TGACAACACCACGTGACGAG,ExtFwd:TTGGGGTGGCTGGATGGTGA,IntFwd:GCTGCAAAAGTTCTGGGTTG,ExtRev:ACGCGTCGCCGTTTGATTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Shimada M, Kanematsu K, Tanaka K, Yokosawa H, Kawahara H.
Proteasomal ubiquitin receptor RPN-10 controls sex determination in Caenorhabditis elegans.
Mol. Biol. Cell 2006 17(12) 5356-71 
[ PubMed ID = 17050737 ] [ RRC reference ]

Sasagawa Y, Otani M, Higashitani N, Higashitani A, Sato K, Ogura T, Yamanaka K.
Caenorhabditis elegans p97 controls germline-specific sex determination by controlling the TRA-1 level in a CUL-2-dependent manner.
J. Cell. Sci. 2009 122(Pt 20) 3663-72 
[ PubMed ID = 19773360 ] [ RRC reference ]

Labbé JC, Pacquelet A, Marty T, Gotta M.
A genomewide screen for suppressors of par-2 uncovers potential regulators of PAR protein-dependent cell polarity in Caenorhabditis elegans.
Genetics 2006 174(1) 285-95 
[ PubMed ID = 16816419 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Saito-Sasagawa Y, Ogura T.
Caenorhabditis elegans UBX cofactors for CDC-48/p97 control spermatogenesis.
Genes Cells 2010 15(12) 1201-15 
[ PubMed ID = 20977550 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Ogura T.
ER E3 ubiquitin ligase HRD-1 and its specific partner chaperone BiP play important roles in ERAD and developmental growth in Caenorhabditis elegans.
Genes Cells 2007 12(9) 1063-73 
[ PubMed ID = 17825049 ] [ RRC reference ]

McCloskey RJ, Kemphues KJ.
Deubiquitylation machinery is required for embryonic polarity in Caenorhabditis elegans.
PLoS Genet. 2012 8(11) e1003092 
[ PubMed ID = 23209443 ] [ RRC reference ]