Allele Name | tm1180 |
Allele Type | 通常株 |
Sequence Name | B0205.3 |
Gene Name | rpn-10 |
Worm Base | Allele Name |
tm1180
|
Gene Name |
rpn-10
|
Sequence |
B0205.3
|
Phenotype
Information from the receiver is posted in the form of a "researcher : phenotype"
| homozygous viable. Dr. H. Kawahara: Mol. Biol. Cell 17, 5356-5371 (2006). Dr. T. Ogura: Genes to Cells: 12, 1063 (2007). Dr. M. Gotta: Genetics 174, 285 (2006). |
Mutation site
Please see gene structure to locate the deletion in relation to exon(s)
| 25624/25625-25981/25982 (357 bp deletion) |
Chromosome | I |
Putative gene structure | complement(join(24954..25325, 25379..25880, 26200..26340, 26392..26450, 26867..27190, 27239..27363, 27414..27579, 27625..27690, 27840..27911)) |
Map position | 5.06 |
Balancer | |
Map position of balancer | |
Sequence of primers | IntRev:TGACAACACCACGTGACGAG,ExtFwd:TTGGGGTGGCTGGATGGTGA,IntFwd:GCTGCAAAAGTTCTGGGTTG,ExtRev:ACGCGTCGCCGTTTGATTTA |
Distributed lab | |
Depositor | Dr. S. Mitani/NBRP |
References |
Please submit your publication
Keith SA, Maddux SK, Zhong Y, Chinchankar MN, Ferguson AA, Ghazi A, Fisher AL. Graded Proteasome Dysfunction in Caenorhabditis elegans Activates an Adaptive Response Involving the Conserved SKN-1 and ELT-2 Transcription Factors and the Autophagy-Lysosome Pathway. PLoS Genet 2016 12(2) e1005823
[ PubMed ID = 26828939 ]
[ RRC reference ]
|
Sasagawa Y, Yamanaka K, Saito-Sasagawa Y, Ogura T. Caenorhabditis elegans UBX cofactors for CDC-48/p97 control spermatogenesis. Genes Cells 2010 15(12) 1201-15
[ PubMed ID = 20977550 ]
[ RRC reference ]
|
McCloskey RJ, Kemphues KJ. Deubiquitylation machinery is required for embryonic polarity in Caenorhabditis elegans. PLoS Genet 2012 8(11) e1003092
[ PubMed ID = 23209443 ]
[ RRC reference ]
|
Sasagawa Y, Otani M, Higashitani N, Higashitani A, Sato K, Ogura T, Yamanaka K. Caenorhabditis elegans p97 controls germline-specific sex determination by controlling the TRA-1 level in a CUL-2-dependent manner. J Cell Sci 2009 122(Pt 20) 3663-72
[ PubMed ID = 19773360 ]
[ RRC reference ]
|
Sasagawa Y, Yamanaka K, Ogura T. ER E3 ubiquitin ligase HRD-1 and its specific partner chaperone BiP play important roles in ERAD and developmental growth in Caenorhabditis elegans. Genes Cells 2007 12(9) 1063-73
[ PubMed ID = 17825049 ]
[ RRC reference ]
|
Shimada M, Kanematsu K, Tanaka K, Yokosawa H, Kawahara H. Proteasomal ubiquitin receptor RPN-10 controls sex determination in Caenorhabditis elegans. Mol Biol Cell 2006 17(12) 5356-71
[ PubMed ID = 17050737 ]
[ RRC reference ]
|
Labbé JC, Pacquelet A, Marty T, Gotta M. A genomewide screen for suppressors of par-2 uncovers potential regulators of PAR protein-dependent cell polarity in Caenorhabditis elegans. Genetics 2006 174(1) 285-95
[ PubMed ID = 16816419 ]
[ RRC reference ]
|
|