Mutants (Isolated)

tm1180

Allele Nametm1180
Sequence NameB0205.3
CGC Namerpn-10
Worm BaseAllele Name tm1180
CGC Name rpn-10
Sequence B0205.3
Phenotypehomozygous viable. Dr. H. Kawahara: Mol. Biol. Cell 17, 5356-5371 (2006). Dr. T. Ogura: Genes to Cells: 12, 1063 (2007). Dr. M. Gotta: Genetics 174, 285 (2006).
Mutation site25624/25625-25981/25982 (357 bp deletion)
ChromosomeI
Putative gene structurecomplement(join(24954..25325, 25379..25880, 26200..26340, 26392..26450, 26867..27190, 27239..27363, 27414..27579, 27625..27690, 27840..27911))
Map position5.06
Balancer
Map position of balancer
Sequence of primersIntRev:TGACAACACCACGTGACGAG,ExtFwd:TTGGGGTGGCTGGATGGTGA,IntFwd:GCTGCAAAAGTTCTGGGTTG,ExtRev:ACGCGTCGCCGTTTGATTTA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Keith SA, Maddux SK, Zhong Y, Chinchankar MN, Ferguson AA, Ghazi A, Fisher AL.
Graded Proteasome Dysfunction in Caenorhabditis elegans Activates an Adaptive Response Involving the Conserved SKN-1 and ELT-2 Transcription Factors and the Autophagy-Lysosome Pathway.
PLoS Genet. 2016 12(2) e1005823 
[ PubMed ID = 26828939 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Saito-Sasagawa Y, Ogura T.
Caenorhabditis elegans UBX cofactors for CDC-48/p97 control spermatogenesis.
Genes Cells 2010 15(12) 1201-15 
[ PubMed ID = 20977550 ] [ RRC reference ]

McCloskey RJ, Kemphues KJ.
Deubiquitylation machinery is required for embryonic polarity in Caenorhabditis elegans.
PLoS Genet. 2012 8(11) e1003092 
[ PubMed ID = 23209443 ] [ RRC reference ]

Sasagawa Y, Otani M, Higashitani N, Higashitani A, Sato K, Ogura T, Yamanaka K.
Caenorhabditis elegans p97 controls germline-specific sex determination by controlling the TRA-1 level in a CUL-2-dependent manner.
J. Cell. Sci. 2009 122(Pt 20) 3663-72 
[ PubMed ID = 19773360 ] [ RRC reference ]

Shimada M, Kanematsu K, Tanaka K, Yokosawa H, Kawahara H.
Proteasomal ubiquitin receptor RPN-10 controls sex determination in Caenorhabditis elegans.
Mol. Biol. Cell 2006 17(12) 5356-71 
[ PubMed ID = 17050737 ] [ RRC reference ]

Labbé JC, Pacquelet A, Marty T, Gotta M.
A genomewide screen for suppressors of par-2 uncovers potential regulators of PAR protein-dependent cell polarity in Caenorhabditis elegans.
Genetics 2006 174(1) 285-95 
[ PubMed ID = 16816419 ] [ RRC reference ]

Sasagawa Y, Yamanaka K, Ogura T.
ER E3 ubiquitin ligase HRD-1 and its specific partner chaperone BiP play important roles in ERAD and developmental growth in Caenorhabditis elegans.
Genes Cells 2007 12(9) 1063-73 
[ PubMed ID = 17825049 ] [ RRC reference ]