Mutants (Isolated)

tm1165

Allele Nametm1165
Sequence NameZK180.1
CGC Namegbb-2
Worm BaseAllele Name tm1165
CGC Name gbb-2
Sequence ZK180.1
Phenotypehomozygous viable. Dr. C.L. Creasy: fertile, normal locomotion, normal egg-laying, solitary social feeding. Dr. J. Kaplan: J. Neurosci 28, 7104 (2008).
Mutation site9048/9049-9412/9413 (364 bp deletion)
ChromosomeIV
Putative gene structurecomplement(join(6639..6663, 6973..7085, 7129..7183, 7537..7627, 7939..8025, 8085..8163, 8573..8674, 9030..9393, 9818..10035, 10343..10417))
Map position0.41
Balancer
Map position of balancer
Sequence of primersExtFwd:TGGTACCATTAGGACTCCTT,IntFwd:AGGACTCCTTTGACTGCATA,ExtRev:CTATTCCAGAGAGCCGGCGA,IntRev:GCCGGCGATGTCTGGAATGA
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Dittman JS, Kaplan JM.
Behavioral impact of neurotransmitter-activated G-protein-coupled receptors: muscarinic and GABAB receptors regulate Caenorhabditis elegans locomotion.
J. Neurosci. 2008 28(28) 7104-12 
[ PubMed ID = 18614679 ] [ RRC reference ]

Chun L, Gong J, Yuan F, Zhang B, Liu H, Zheng T, Yu T, Xu XZ, Liu J.
Metabotropic GABA signalling modulates longevity in C. elegans.
Nat Commun 2015 6 8828 
[ PubMed ID = 26537867 ] [ RRC reference ]

Han B, Bellemer A, Koelle MR.
An evolutionarily conserved switch in response to GABA affects development and behavior of the locomotor circuit of Caenorhabditis elegans.
Genetics 2015 199(4) 1159-72 
[ PubMed ID = 25644702 ] [ RRC reference ]

Hawkins EG, Martin I, Kondo LM, Judy ME, Brings VE, Chan CL, Blackwell GG, Bettinger JC, Davies AG.
A novel cholinergic action of alcohol and the development of tolerance to that effect in Caenorhabditis elegans.
Genetics 2015 199(1) 135-49 
[ PubMed ID = 25342716 ] [ RRC reference ]

Schultheis C, Brauner M, Liewald JF, Gottschalk A.
Optogenetic analysis of GABAB receptor signaling in Caenorhabditis elegans motor neurons.
J. Neurophysiol. 2011 106(2) 817-27 
[ PubMed ID = 21613582 ] [ RRC reference ]