Mutants (Isolated)

tm1163

Allele Nametm1163
Sequence NameT23D8.7
CGC Namehpo-24
Worm BaseAllele Name tm1163
CGC Name hpo-24
Sequence T23D8.7
Phenotypehomozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006).
Mutation site28137/28138-28572/28573 (435 bp deletion)
ChromosomeI
Putative gene structurejoin(26949..27068, 27120..27187, 27232..27606, 27661..28621, 28689..28819, 29049..29748, 30273..30464, 30510..30659)
Map position4.14
Balancer
Map position of balancer
Sequence of primersExtFwd:CCGTTTTACCTGATACCGTG,IntFwd:GCCGATGGTCTCTTTGCGTT,ExtRev:GTCTGGTTCTGCGTATCTGA,IntRev:CGGTTATGCCGATATATGCA
Distributed lab
DepositorDr. S. Mitani
References Please submit your publication
Brown KC, Svendsen JM, Tucci RM, Montgomery BE, Montgomery TA.
ALG-5 is a miRNA-associated Argonaute required for proper developmental timing in the Caenorhabditis elegans germline.
Nucleic Acids Res. 2017 45(15) 9093-9107 
[ PubMed ID = 28645154 ] [ RRC reference ]

She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet. 2009 5(8) e1000624 
[ PubMed ID = 19714217 ] [ RRC reference ]