| Allele Name | tm1163 |
| Sequence Name | T23D8.7 |
| CGC Name | hpo-24 |
| Worm Base | Allele Name |
tm1163
|
| CGC Name |
hpo-24
|
| Sequence |
T23D8.7
|
| Phenotype | homozygous viable. Dr. C. Mello, Cell 127, 747-457 (2006). |
| Mutation site | 28137/28138-28572/28573 (435 bp deletion) |
| Chromosome | I |
| Putative gene structure | join(26949..27068, 27120..27187, 27232..27606, 27661..28621, 28689..28819, 29049..29748, 30273..30464, 30510..30659) |
| Map position | 4.14 |
| Balancer | |
| Map position of balancer | |
| Sequence of primers | ExtFwd:CCGTTTTACCTGATACCGTG,IntFwd:GCCGATGGTCTCTTTGCGTT,ExtRev:GTCTGGTTCTGCGTATCTGA,IntRev:CGGTTATGCCGATATATGCA |
| Distributed lab | |
| Depositor | Dr. S. Mitani |
| References |
Please submit your publication
Takagaki N, Ohta A, Ohnishi K, Kawanabe A, Minakuchi Y, Toyoda A, Fujiwara Y, Kuhara A.
The mechanoreceptor DEG-1 regulates cold tolerance in Caenorhabditis elegans.
EMBO Rep 2020 21(3) e48671
[ PubMed ID = 32009302 ]
[ RRC reference ]
|
Brown KC, Svendsen JM, Tucci RM, Montgomery BE, Montgomery TA.
ALG-5 is a miRNA-associated Argonaute required for proper developmental timing in the Caenorhabditis elegans germline.
Nucleic Acids Res 2017 45(15) 9093-9107
[ PubMed ID = 28645154 ]
[ RRC reference ]
|
She X, Xu X, Fedotov A, Kelly WG, Maine EM.
Regulation of heterochromatin assembly on unpaired chromosomes during Caenorhabditis elegans meiosis by components of a small RNA-mediated pathway.
PLoS Genet 2009 5(8) e1000624
[ PubMed ID = 19714217 ]
[ RRC reference ]
|
|
Copyright © 2009 NBRP-C. elegans. All rights reserved.