Home > Mutants (Isolated) > tm11521

Mutants (Isolated)

tm11521

Allele Nametm11521
BalanceNot Required
OutCrossRequest Available
Sequence NameF11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.13
Gene NameF11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.13
Worm BaseAllele Name tm11521
Gene Name F11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.13
Sequence F11G11.4 F11G11.9 F11G11.14 F11G11.10 F11G11.11 F11G11.12 F11G11.13
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) 10105/10106-29497/29498 (19392 bp deletion)
ChromosomeII
Putative gene structureF11G11.4 = join(10764..11022, 11164..11291); F11G11.9 = complement(join(12003..12274, 12323..12424, 12586..12664, 12714..13094)); F11G11.14 F11G11.10 = complement(join(16231..16329, 16377..17111)); F11G11.11 = complement(join(19465..20267, 20396..20459)); F11G11.12 = complement(join(21905..21951, 22004..22814)); F11G11.13 = complement(join(24968..25129, 25175..25265, 25323..25390))
Map position
Balancer
Map position of balancer
Sequence of primersIntRev:CAGATTCTCCTCGGAATAATCC,IntFwd:CGGGCCTTGAAGACCTGTCC,ExtRev:TCACTATTTTTGCGTGCTGG,ExtFwd:TTATGGTCCAAGGTAGCACG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication