分離済み変異体

tm11488

Allele Nametm11488
BalanceNot Required
OutCrossRequest Available
Sequence NameC49H3.1 F20D12.3 F20D12.9 F20D12.7 F20D12.5 F20D12.8 F20D12.4 F20D12.12 F20D12.10 F20D12.2 F20D12.6 F20D12.1
Gene NameC49H3.1 F20D12.3 F20D12.9 F20D12.7 F20D12.5 F20D12.8 F20D12.4 F20D12.12 F20D12.10 F20D12.2 F20D12.6 F20D12.1
Worm BaseAllele Name tm11488
Gene Name C49H3.1 F20D12.3 F20D12.9 F20D12.7 F20D12.5 F20D12.8 F20D12.4 F20D12.12 F20D12.10 F20D12.2 F20D12.6 F20D12.1
Sequence C49H3.1 F20D12.3 F20D12.9 F20D12.7 F20D12.5 F20D12.8 F20D12.4 F20D12.12 F20D12.10 F20D12.2 F20D12.6 F20D12.1
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [C49H3]36814/36815-[F20D12]33415/33416 (32117 bp deletion)
ChromosomeIV
Putative gene structureC49H3.1 = join(31727..32046, 32178..32403, 32492..32569, 33015..33255, 33303..33502, 33547..33639, 33721..34113, 34437..34558, 34608..34848, 34989..35812, 36048..36263, 36311..36533, 36717..37160); F20D12.3 = join(2116..2326, 2381..2556, 2612..3253, 3615..3829, 3880..3990, 4037..4175, 4277..4481, 4527..4561, 5115..5227, 5281..5352, 5420..5496, 5544..5647); F20D12.9 F20D12.7 = complement(join(5947..6072, 6195..6451, 6829..6922)); F20D12.5 = complement(join(8007..8012, 8261..8371, 8607..8707, 8755..8794)); F20D12.8 F20D12.4 = complement(join(11743..11874, 12214..13024, 13073..13615, 13670..14226, 14270..14563)); F20D12.12 F20D12.10 F20D12.2 = join(16665..16725, 16769..16960, 17005..17276, 17328..17451, 17513..17946, 18666..19673, 19724..20303, 20616..20966, 21036..21227, 21277..21413); F20D12.6 = complement(join(21630..21792, 22488..22582, 22635..22738, 22791..22797)); F20D12.1 = join(25568..26042, 26587..26746, 26788..26941, 26985..27196, 27241..27392, 27440..27825, 27871..28592, 28637..28736, 28781..29137, 29188..29376, 29420..29508, 29555..29651)
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:TCAAGGCGTCAATGGGAAGAG,ExtFwd:TGTATCAGGTGTACCAGAAG,IntRev:TCTTCTCACATCTAGCCCGG,IntFwd:CATAAGGTTTGATAGCAGGC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication