分離済み変異体

tm11486

Allele Nametm11486
BalanceNot Required
OutCrossCompleted
Sequence NameC26H9A.1 C26H9A.2 VT23B5.1 T23B5.4 T23B5.6 T23B5.1 T23B5.3 T23B5.5
Gene NameC26H9A.1 C26H9A.2 VT23B5.1 T23B5.4 T23B5.6 T23B5.1 T23B5.3 T23B5.5
Worm BaseAllele Name tm11486 (x1)
Gene Name C26H9A.1 C26H9A.2 VT23B5.1 T23B5.4 T23B5.6 T23B5.1 T23B5.3 T23B5.5
Sequence C26H9A.1 C26H9A.2 VT23B5.1 T23B5.4 T23B5.6 T23B5.1 T23B5.3 T23B5.5
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [C26H9A]11425/11426-AGG-[T23B5]22520/22521 (44420 bp deletion + 3 bp insertion)
ChromosomeIV
Putative gene structureC26H9A.1 = join(5168..5416, 5470..5784, 6185..6241, 6295..6386, 6593..6719, 6766..6848, 6900..7026, 7085..7174, 7222..7308, 7819..7969, 8427..8566, 8608..8744, 8792..8885, 9261..9406, 9992..10143, 10192..10325, 10510..10710, 10925..11096, 11149..11258, 12117..12353); C26H9A.2 = join(15410..15813, 16416..16634, 16683..16815, 17475..17621, 17672..17754, 17802..18003, 18060..18277, 18799..18904, 18953..19202, 19824..19918, 19973..20029, 20083..20328, 20461..21080, 21518..21783, 22156..22442, 22728..22820, 23084..23238, 23530..23665, 23710..23808, 23856..24044); VT23B5.1 = join(17..189, 238..438, 919..1491, 1774..2162, 2453..2565, 2612..3118, 3809..4744); T23B5.4 = join(3812..3889, 3962..4057, 4316..4426, 4470..4562); T23B5.6 T23B5.1 = complement(join(6394..6456, 6514..6639, 7490..7842, 8486..8702, 9376..9541, 9605..9906, 11283..11541, 11597..11706, 12474..12751, 12806..12974)); T23B5.3 = join(20586..20633, 20819..21088, 21138..21216, 21713..21973, 22083..22300, 22726..23064, 23127..23248, 25460..25697, 26177..26269, Z80214.1:1901..2097, Z80214.1:2145..2238, Z80214.1:2296..2607, Z80214.1:3146..3346); T23B5.5
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:CTGCTTCTCCCGACTCGTAG,ExtFwd:TTATCGTTGGCTCATGCACG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication