分離済み変異体

tm11477

Allele Nametm11477
BalanceNot Required
OutCrossRequest Available
Sequence NameT08D10.4 T08D10.3 T08D10.5 C49F5.8 C49F5.12 C49F5.13 C49F5.9 C49F5.1 VW06B3R.1 C49F5.2 C49F5.4 C49F5.3 C49F5.5 C49F5.6 C49F5.10 C49F5.11 C49F5.t1 C49F5.7 W06B3.2
Gene NameT08D10.4 T08D10.3 T08D10.5 C49F5.8 C49F5.12 C49F5.13 C49F5.9 C49F5.1 VW06B3R.1 C49F5.2 C49F5.4 C49F5.3 C49F5.5 C49F5.6 C49F5.10 C49F5.11 C49F5.t1 C49F5.7 W06B3.2
Worm BaseAllele Name tm11477
Gene Name T08D10.4 T08D10.3 T08D10.5 C49F5.8 C49F5.12 C49F5.13 C49F5.9 C49F5.1 VW06B3R.1 C49F5.2 C49F5.4 C49F5.3 C49F5.5 C49F5.6 C49F5.10 C49F5.11 C49F5.t1 C49F5.7 W06B3.2
Sequence T08D10.4 T08D10.3 T08D10.5 C49F5.8 C49F5.12 C49F5.13 C49F5.9 C49F5.1 VW06B3R.1 C49F5.2 C49F5.4 C49F5.3 C49F5.5 C49F5.6 C49F5.10 C49F5.11 C49F5.t1 C49F5.7 W06B3.2
Phenotype Information from the receiver is posted in the form of a "researcher : phenotype" homozygous viable
Mutation site Please see gene structure to locate the deletion in relation to exon(s) [T08D10]7695/7696-[W06B3]7907/7908 (53885 bp deletion)
ChromosomeX
Putative gene structureT08D10.4 T08D10.3 = join(10674..10754, 10804..10983, 11046..11267, 12213..12526, 12786..13327, 13527..13609); T08D10.5 C49F5.8 = join(1113..1222, 1448..1585, 1630..1746, 2090..2174, 2221..2286); C49F5.12 C49F5.13 C49F5.9 C49F5.1 = join(7332..7400, 7454..7637, 7692..8484, 8532..8697); VW06B3R.1 C49F5.2 = complement(join(11611..11838, 11905..12024, 12559..13110, 13163..13294, 13825..14077, 14125..14432, 14578..14682, 14797..14898, 15474..15569, 15668..15811, 15894..15980)); C49F5.4 = complement(join(21557..21819, 21869..22477, 22531..22627, 23226..23288)); C49F5.3 = complement(join(24095..24343, 24453..24578, 24626..24823, 24870..24994, 25125..25203)); C49F5.5 = join(27184..27290, 27491..27599, 28032..28158, 28421..28533); C49F5.6 = join(29680..29943, 30025..30246, 30298..30393, 30448..31824, 31875..32225, 32272..32316); C49F5.10 C49F5.11 C49F5.t1 = complement(34825..34896); C49F5.7 = join(36153..36188, 36856..37086); W06B3.2 = complement(join(39326..39395, 39615..39711, 39804..39848, AL022275.1:105..177, AL022275.1:312..467, AL022275.1:516..980, AL022275.1:1531..1640, AL022275.1:1801..1960, AL022275.1:2014..2192, AL022275.1:2764..2905))
Map position
Balancer
Map position of balancer
Sequence of primersExtRev:TTCTTTCCCTCTGTGTACGG,ExtFwd:GGAGATGATGGTAGCACAAG
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication