Mutants (Isolated)

tm1146

Allele Nametm1146
Sequence NameZK430.3
CGC Namesod-5
Worm BaseAllele Name tm1146
CGC Name sod-5
Sequence ZK430.3
Phenotypehomozygous viable. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).
Mutation site24926/24927-25701/25702 (775 bp deletion)
ChromosomeII
Putative gene structurejoin(24739..24780, 24892..24975, 25564..25722, 25771..25924, 25970..26067)
Map position-4.69
Balancer
Map position of balancer
Sequence of primersIntRev:GATCGACGTGGACAACCATG,IntFwd:GCATCTGCCTTGTCGTGGAT,ExtRev:GGCCTTGTCGTCGATTCCCT,ExtFwd:AATGGCGGAAGGATAGCATC
Distributed lab
DepositorDr. S. Mitani/NBRP
References Please submit your publication
Jensen LT, Culotta VC.
Activation of CuZn superoxide dismutases from Caenorhabditis elegans does not require the copper chaperone CCS.
J. Biol. Chem. 2005 280(50) 41373-9 
[ PubMed ID = 16234242 ] [ RRC reference ]

Dues DJ, Schaar CE, Johnson BK, Bowman MJ, Winn ME, Senchuk MM, Van Raamsdonk JM.
Uncoupling of oxidative stress resistance and lifespan in long-lived isp-1 mitochondrial mutants in Caenorhabditis elegans.
Free Radic. Biol. Med. 2017 108 362-373 
[ PubMed ID = 28392283 ] [ RRC reference ]

Laranjeiro R, Harinath G, Burke D, Braeckman BP, Driscoll M.
Single swim sessions in C. elegans induce key features of mammalian exercise.
BMC Biol. 2017 15(1) 30 
[ PubMed ID = 28395669 ] [ RRC reference ]

Sakamoto T, Imai H.
Hydrogen peroxide produced by superoxide dismutase SOD-2 activates sperm in Caenorhabditis elegans.
J. Biol. Chem. 2017 292(36) 14804-14813 
[ PubMed ID = 28724632 ] [ RRC reference ]

Rangaraju S, Solis GM, Andersson SI, Gomez-Amaro RL, Kardakaris R, Broaddus CD, Niculescu AB 3rd, Petrascheck M.
Atypical antidepressants extend lifespan of Caenorhabditis elegans by activation of a non-cell-autonomous stress response.
Aging Cell 2015 14(6) 971-81 
[ PubMed ID = 26255886 ] [ RRC reference ]

Wu Q, Zhao Y, Li Y, Wang D.
Molecular signals regulating translocation and toxicity of graphene oxide in the nematode Caenorhabditis elegans.
Nanoscale 2014 6(19) 11204-12 
[ PubMed ID = 25124895 ] [ RRC reference ]

Labuschagne CF, Stigter EC, Hendriks MM, Berger R, Rokach J, Korswagen HC, Brenkman AB.
Quantification of in vivo oxidative damage in Caenorhabditis elegans during aging by endogenous F3-isoprostane measurement.
Aging Cell 2013 12(2) 214-23 
[ PubMed ID = 23279719 ] [ RRC reference ]

Van Raamsdonk JM, Hekimi S.
Deletion of the mitochondrial superoxide dismutase sod-2 extends lifespan in Caenorhabditis elegans.
PLoS Genet. 2009 5(2) e1000361 
[ PubMed ID = 19197346 ] [ RRC reference ]

Han Y, Song S, Wu H, Zhang J, Ma E.
Antioxidant enzymes and their role in phoxim and carbaryl stress in Caenorhabditis elegans.
Pestic Biochem Physiol 2017 138 43-50 
[ PubMed ID = 28456303 ] [ RRC reference ]

De Henau S, Tilleman L, Vangheel M, Luyckx E, Trashin S, Pauwels M, Germani F, Vlaeminck C, Vanfleteren JR, Bert W, Pesce A, Nardini M, Bolognesi M, De Wael K, Moens L, Dewilde S, Braeckman BP.
A redox signalling globin is essential for reproduction in Caenorhabditis elegans.
Nat Commun 2015 6 8782 
[ PubMed ID = 26621324 ] [ RRC reference ]

Schaar CE, Dues DJ, Spielbauer KK, Machiela E, Cooper JF, Senchuk M, Hekimi S, Van Raamsdonk JM.
Mitochondrial and cytoplasmic ROS have opposing effects on lifespan.
PLoS Genet. 2015 11(2) e1004972 
[ PubMed ID = 25671321 ] [ RRC reference ]

Xu S, Chisholm AD.
C. elegans epidermal wounding induces a mitochondrial ROS burst that promotes wound repair.
Dev. Cell 2014 31(1) 48-60 
[ PubMed ID = 25313960 ] [ RRC reference ]

Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979 
[ PubMed ID = 29367452 ] [ RRC reference ]

Song S, Zhang X, Wu H, Han Y, Zhang J, Ma E, Guo Y.
Molecular basis for antioxidant enzymes in mediating copper detoxification in the nematode Caenorhabditis elegans.
PLoS ONE 2014 9(9) e107685 
[ PubMed ID = 25243607 ] [ RRC reference ]

Erkut C, Vasilj A, Boland S, Habermann B, Shevchenko A, Kurzchalia TV.
Molecular strategies of the Caenorhabditis elegans dauer larva to survive extreme desiccation.
PLoS ONE 2013 8(12) e82473 
[ PubMed ID = 24324795 ] [ RRC reference ]