Mutants (Isolated)

tm1146

Allele Name

tm1146

Allele Type

Normal

Sequence Name

ZK430.3

Gene Name

sod-5

Worm Base

Allele Name

tm1146

Gene Name

sod-5

Sequence

ZK430.3

Phenotype

homozygous viable. Dr. S. Hekimi: PLoS Genetics 5, e1000361 (2009).

Mutation site

24926/24927-25701/25702 (775 bp deletion)

Chromosome

Putative gene structure

join(24739..24780, 24892..24975, 25564..25722, 25771..25924, 25970..26067)

Map position

-4.69

Balancer

Map position of balancer

Sequence of primers

IntRev:GATCGACGTGGACAACCATG,IntFwd:GCATCTGCCTTGTCGTGGAT,ExtRev:GGCCTTGTCGTCGATTCCCT,ExtFwd:AATGGCGGAAGGATAGCATC

Distributed lab

Depositor

Dr. S. Mitani/NBRP

References

Please submit your publication

Wong CH, Haque MA, Chang HC.
Superoxide dismutase SOD-3 regulates redox homeostasis in the intestine.
MicroPubl Biol 2023 2023
[ PubMed ID = 38188420 ] [ RRC reference ]

Eck RJ, Stair JG, Kraemer BC, Liachko NF.
Simple models to understand complex disease: 10 years of progress from Caenorhabditis elegans models of amyotrophic lateral sclerosis and frontotemporal lobar degeneration.
Front Neurosci 2023 17 1300705
[ PubMed ID = 38239833 ] [ RRC reference ]

Zhao L, Fenk LA, Nilsson L, Amin-Wetzel NP, Ramirez-Suarez NJ, de Bono M, Chen C.
ROS and cGMP signaling modulate persistent escape from hypoxia in Caenorhabditis elegans.
PLoS Biol 2022 20(6) e3001684
[ PubMed ID = 35727855 ] [ RRC reference ]

Chen H, Li R, Zhao F, Luan L, Han T, Li Z.
Betulinic acid increases lifespan and stress resistance via insulin/IGF-1 signaling pathway in Caenorhabditis elegans.
Front Nutr 2022 9 960239
[ PubMed ID = 35967806 ] [ RRC reference ]

Branicky R, Wang Y, Khaki A, Liu JL, Kramer-Drauberg M, Hekimi S.
Stimulation of RAS-dependent ROS signaling extends longevity by modulating a developmental program of global gene expression.
Sci Adv 2022 8(48) eadc9851
[ PubMed ID = 36449615 ] [ RRC reference ]

Hershberger KA, Rooney JP, Turner EA, Donoghue LJ, Bodhicharla R, Maurer LL, Ryde IT, Kim JJ, Joglekar R, Hibshman JD, Smith LL, Bhatt DP, Ilkayeva OR, Hirschey MD, Meyer JN.
Early-life mitochondrial DNA damage results in lifelong deficits in energy production mediated by redox signaling in Caenorhabditis elegans.
Redox Biol 2021 43 102000
[ PubMed ID = 33993056 ] [ RRC reference ]

Gaidamakova EK, Sharma A, Matrosova VY, Grichenko O, Volpe RP, Tkavc R, Conze IH, Klimenkova P, Balygina I, Horne WH, Gostinčar C, Chen X, Makarova KS, Shuryak I, Srinivasan C, Jackson-Thompson B, Hoffman BM, Daly MJ.
Small-Molecule Mn Antioxidants in Caenorhabditis elegans and Deinococcus radiodurans Supplant MnSOD Enzymes during Aging and Irradiation.
mBio 2022 13(1) e0339421
[ PubMed ID = 35012337 ] [ RRC reference ]

Fernando LM, Adeel S, Basar MA, Allen AK, Duttaroy A.
In-gel SOD assay reveals SOD-2 is the single active, water-soluble SOD enzyme in C. elegans.
Free Radic Res 2021 55(6) 619-624
[ PubMed ID = 34514925 ] [ RRC reference ]

Yanase S, Yasuda K, Ishii N.
Interaction between the ins/IGF-1 and p38 MAPK signaling pathways in molecular compensation of sod genes and modulation related to intracellular ROS levels in C. elegans.
Biochem Biophys Rep 2020 23 100796
[ PubMed ID = 32875124 ] [ RRC reference ]

Tjahjono E, McAnena AP, Kirienko NV.
The evolutionarily conserved ESRE stress response network is activated by ROS and mitochondrial damage.
BMC Biol 2020 18(1) 74
[ PubMed ID = 32600387 ] [ RRC reference ]

Kelley CA, De Henau S, Bell L, Dansen TB, Cram EJ.
Redox signaling modulates Rho activity and tissue contractility in the Caenorhabditis elegans spermatheca.
Mol Biol Cell 2020 31(14) 1486-1497
[ PubMed ID = 32374641 ] [ RRC reference ]

Zhang M, Li Z, Gao D, Gong W, Gao Y, Zhang C.
Hydrogen extends Caenorhabditis elegans longevity by reducing reactive oxygen species.
PLoS One 2020 15(4) e0231972
[ PubMed ID = 32320994 ] [ RRC reference ]

Dues DJ, Andrews EK, Senchuk MM, Van Raamsdonk JM.
Resistance to Stress Can Be Experimentally Dissociated From Longevity.
J Gerontol A Biol Sci Med Sci 2019 74(8) 1206-1214
[ PubMed ID = 30247515 ] [ RRC reference ]

Zhao T, Hao Y, Kaplan JM.
Axonal Mitochondria Modulate Neuropeptide Secretion Through the Hypoxic Stress Response in Caenorhabditis elegans.
Genetics 2018 210(1) 275-285
[ PubMed ID = 30049781 ] [ RRC reference ]

Xiao G, Zhao L, Huang Q, Yang J, Du H, Guo D, Xia M, Li G, Chen Z, Wang D.
Toxicity evaluation of Wanzhou watershed of Yangtze Three Gorges Reservior in the flood season in Caenorhabditis elegans.
Sci Rep 2018 8(1) 6734
[ PubMed ID = 29712953 ] [ RRC reference ]

Luz AL, Godebo TR, Bhatt DP, Ilkayeva OR, Maurer LL, Hirschey MD, Meyer JN.
From the Cover: Arsenite Uncouples Mitochondrial Respiration and Induces a Warburg-like Effect in Caenorhabditis elegans.
Toxicol Sci 2016 152(2) 349-62
[ PubMed ID = 27208080 ] [ RRC reference ]

Na HS, Brockway NL, Gentry KR, Opheim E, Sedensky MM, Morgan PG.
The genetics of isoflurane-induced developmental neurotoxicity.
Neurotoxicol Teratol 2017 60 40-49
[ PubMed ID = 27989695 ] [ RRC reference ]

Nordquist SK, Smith SR, Pierce JT.
Systematic Functional Characterization of Human 21st Chromosome Orthologs in Caenorhabditis elegans.
G3 (Bethesda) 2018 8(3) 967-979
[ PubMed ID = 29367452 ] [ RRC reference ]

Sakamoto T, Imai H.
Hydrogen peroxide produced by superoxide dismutase SOD-2 activates sperm in Caenorhabditis elegans.
J Biol Chem 2017 292(36) 14804-14813
[ PubMed ID = 28724632 ] [ RRC reference ]